Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2026191..2026336 | Replicon | chromosome |
Accession | NZ_CP039524 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2026227..2026329 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2026191..2026336 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
E8Q43_RS10110 | 2021321..2023381 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
E8Q43_RS10115 | 2023385..2024044 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
E8Q43_RS10120 | 2024123..2024353 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
E8Q43_RS10125 | 2024466..2024840 | + | 375 | WP_039819395.1 | CopC domain-containing protein YobA | - |
E8Q43_RS10130 | 2024844..2025713 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
E8Q43_RS10135 | 2025730..2026068 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2026191..2026336 | - | 146 | - | - | Antitoxin |
- | 2026227..2026329 | + | 103 | - | - | Toxin |
E8Q43_RS10140 | 2026705..2026848 | - | 144 | WP_038431282.1 | Ecr family regulatory small membrane protein | - |
E8Q43_RS10145 | 2026953..2027921 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
E8Q43_RS10150 | 2028078..2028731 | + | 654 | WP_024622748.1 | protein-serine/threonine phosphatase | - |
E8Q43_RS10155 | 2028728..2028919 | - | 192 | WP_002911395.1 | YebW family protein | - |
E8Q43_RS10160 | 2029017..2029256 | - | 240 | WP_002911393.1 | YebV family protein | - |
E8Q43_RS10165 | 2029372..2030805 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T124075 NZ_CP039524:2026227-2026329 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT124075 NZ_CP039524:c2026336-2026191 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT