Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2004864..2005009 | Replicon | chromosome |
| Accession | NZ_CP039502 | ||
| Organism | Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2004904..2005007 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2004864..2005009 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SEEB0189_RS09990 | 2001290..2001988 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| SEEB0189_RS09995 | 2002012..2002668 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| SEEB0189_RS10000 | 2002776..2003006 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| SEEB0189_RS10005 | 2003144..2003518 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| SEEB0189_RS10010 | 2003519..2004394 | + | 876 | WP_020839281.1 | copper homeostasis membrane protein CopD | - |
| SEEB0189_RS10015 | 2004411..2004764 | + | 354 | WP_000722367.1 | YebY family protein | - |
| - | 2004864..2005009 | - | 146 | - | - | Antitoxin |
| - | 2004904..2005007 | + | 104 | - | - | Toxin |
| SEEB0189_RS10020 | 2005138..2006060 | - | 923 | Protein_1871 | tyrosine-type recombinase/integrase | - |
| SEEB0189_RS10025 | 2006324..2006785 | - | 462 | Protein_1872 | DNA breaking-rejoining protein | - |
| SEEB0189_RS10030 | 2006774..2006965 | + | 192 | Protein_1873 | glycoside hydrolase family 19 protein | - |
| SEEB0189_RS10035 | 2007019..2007552 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| SEEB0189_RS10040 | 2007809..2007976 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| SEEB0189_RS10045 | 2008041..2008229 | - | 189 | WP_001532317.1 | hypothetical protein | - |
| SEEB0189_RS10050 | 2008284..2008775 | + | 492 | WP_020839284.1 | DUF1441 family protein | - |
| SEEB0189_RS10055 | 2008762..2009329 | + | 568 | Protein_1878 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1982993..2039309 | 56316 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T124047 NZ_CP039502:2004904-2005007 [Salmonella enterica subsp. enterica serovar Bareilly str.]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT124047 NZ_CP039502:c2005009-2004864 [Salmonella enterica subsp. enterica serovar Bareilly str.]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
