Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 3258252..3258397 | Replicon | chromosome |
| Accession | NZ_CP039452 | ||
| Organism | Enterobacter bugandensis strain 1367 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 3258287..3258390 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 3258252..3258397 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FBF68_RS15585 | 3254735..3255397 | - | 663 | WP_025756911.1 | exodeoxyribonuclease X | - |
| FBF68_RS15590 | 3255422..3256072 | - | 651 | WP_045260312.1 | carbon-nitrogen hydrolase family protein | - |
| FBF68_RS15595 | 3256183..3256413 | - | 231 | WP_008500465.1 | DNA polymerase III subunit theta | - |
| FBF68_RS15600 | 3256550..3256921 | + | 372 | WP_045260311.1 | CopC domain-containing protein YobA | - |
| FBF68_RS15605 | 3256923..3257792 | + | 870 | WP_063155605.1 | copper homeostasis membrane protein CopD | - |
| FBF68_RS15610 | 3257809..3258147 | + | 339 | WP_063155606.1 | YebY family protein | - |
| - | 3258252..3258397 | - | 146 | - | - | Antitoxin |
| - | 3258287..3258390 | + | 104 | - | - | Toxin |
| FBF68_RS15615 | 3258467..3259552 | - | 1086 | WP_063155607.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| FBF68_RS15620 | 3259521..3259792 | - | 272 | Protein_2980 | excisionase | - |
| FBF68_RS15625 | 3260415..3260636 | - | 222 | WP_063155608.1 | TraR/DksA family transcriptional regulator | - |
| FBF68_RS15630 | 3260728..3261243 | - | 516 | WP_063155609.1 | hypothetical protein | - |
| FBF68_RS15635 | 3261240..3261458 | - | 219 | WP_063155610.1 | hypothetical protein | - |
| FBF68_RS15640 | 3261455..3261604 | - | 150 | Protein_2984 | adenine methyltransferase | - |
| FBF68_RS15645 | 3261605..3261901 | + | 297 | Protein_2985 | antiterminator | - |
| FBF68_RS15655 | 3262511..3262735 | + | 225 | WP_063155612.1 | class II holin family protein | - |
| FBF68_RS15660 | 3262713..3263207 | + | 495 | WP_063155613.1 | lysozyme | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 3252678..3280386 | 27708 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T123978 NZ_CP039452:3258287-3258390 [Enterobacter bugandensis]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT123978 NZ_CP039452:c3258397-3258252 [Enterobacter bugandensis]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT