Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2307648..2307919 | Replicon | chromosome |
Accession | NZ_CP038402 | ||
Organism | Escherichia coli O157:H7 strain BB24-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2307778..2307881 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2307648..2307919 (-) |
Genomic Context
Location: 2306016..2306390 (375 bp)
Type: Others
Protein ID: WP_000168751.1
Type: Others
Protein ID: WP_000168751.1
Location: 2306394..2307266 (873 bp)
Type: Others
Protein ID: WP_000879314.1
Type: Others
Protein ID: WP_000879314.1
Location: 2307279..2307620 (342 bp)
Type: Others
Protein ID: WP_000976483.1
Type: Others
Protein ID: WP_000976483.1
Location: 2307778..2307881 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2308016..2308672 (657 bp)
Type: Others
Protein ID: WP_000812736.1
Type: Others
Protein ID: WP_000812736.1
Location: 2304203..2304865 (663 bp)
Type: Others
Protein ID: WP_000944243.1
Type: Others
Protein ID: WP_000944243.1
Location: 2304889..2305545 (657 bp)
Type: Others
Protein ID: WP_000011656.1
Type: Others
Protein ID: WP_000011656.1
Location: 2305647..2305877 (231 bp)
Type: Others
Protein ID: WP_000916763.1
Type: Others
Protein ID: WP_000916763.1
Location: 2307648..2307919 (272 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2308673..2308864 (192 bp)
Type: Others
Protein ID: WP_001296140.1
Type: Others
Protein ID: WP_001296140.1
Location: 2308969..2309205 (237 bp)
Type: Others
Protein ID: WP_001295499.1
Type: Others
Protein ID: WP_001295499.1
Location: 2309323..2310762 (1440 bp)
Type: Others
Protein ID: WP_001302304.1
Type: Others
Protein ID: WP_001302304.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
E4U87_RS11610 | 2304203..2304865 | - | 663 | WP_000944243.1 | exodeoxyribonuclease X | - |
E4U87_RS11615 | 2304889..2305545 | - | 657 | WP_000011656.1 | carbon-nitrogen hydrolase family protein | - |
E4U87_RS11620 | 2305647..2305877 | - | 231 | WP_000916763.1 | DNA polymerase III subunit theta | - |
E4U87_RS11625 | 2306016..2306390 | + | 375 | WP_000168751.1 | CopC domain-containing protein YobA | - |
E4U87_RS11630 | 2306394..2307266 | + | 873 | WP_000879314.1 | copper homeostasis membrane protein CopD | - |
E4U87_RS11635 | 2307279..2307620 | + | 342 | WP_000976483.1 | YebY family protein | - |
- | 2307648..2307919 | - | 272 | - | - | Antitoxin |
- | 2307778..2307881 | + | 104 | - | - | Toxin |
E4U87_RS11640 | 2308016..2308672 | + | 657 | WP_000812736.1 | protein-serine/threonine phosphatase | - |
E4U87_RS11645 | 2308673..2308864 | - | 192 | WP_001296140.1 | YebW family protein | - |
E4U87_RS11650 | 2308969..2309205 | - | 237 | WP_001295499.1 | DUF1480 family protein | - |
E4U87_RS11655 | 2309323..2310762 | - | 1440 | WP_001302304.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T122397 NZ_CP038402:2307778-2307881 [Escherichia coli O157:H7]
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
Antitoxin
Download Length: 272 bp
>AT122397 NZ_CP038402:c2307919-2307648 [Escherichia coli O157:H7]
AAAGTCAGCGAAGGAAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGCGGTGGTCATCAGCTTAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT
AAAGTCAGCGAAGGAAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGCGGTGGTCATCAGCTTAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT