Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 46642..46787 | Replicon | chromosome |
Accession | NZ_CP036327 | ||
Organism | Klebsiella pneumoniae strain BA28434 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 46678..46780 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 46642..46787 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
C3E96_RS00235 | 41772..43832 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
C3E96_RS00240 | 43836..44495 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
C3E96_RS00245 | 44574..44804 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
C3E96_RS00250 | 44917..45291 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
C3E96_RS00255 | 45295..46164 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
C3E96_RS00260 | 46181..46519 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 46642..46787 | - | 146 | - | - | Antitoxin |
- | 46678..46780 | + | 103 | - | - | Toxin |
C3E96_RS29010 | 47156..47299 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
C3E96_RS00270 | 47404..48372 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
C3E96_RS00275 | 48529..49182 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
C3E96_RS00280 | 49179..49370 | - | 192 | WP_002911395.1 | YebW family protein | - |
C3E96_RS00285 | 49468..49707 | - | 240 | WP_002911393.1 | YebV family protein | - |
C3E96_RS00290 | 49823..51256 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 3783..54013 | 50230 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T119567 NZ_CP036327:46678-46780 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT119567 NZ_CP036327:c46787-46642 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT