Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2025049..2025194 | Replicon | chromosome |
Accession | NZ_CP036305 | ||
Organism | Klebsiella pneumoniae strain WCHKP020098 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2025085..2025187 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2025049..2025194 (-) |
Genomic Context
Location: 2020179..2022239 (2061 bp)
Type: Others
Protein ID: WP_004151449.1
Type: Others
Protein ID: WP_004151449.1
Location: 2023324..2023698 (375 bp)
Type: Others
Protein ID: WP_004151448.1
Type: Others
Protein ID: WP_004151448.1
Location: 2023702..2024571 (870 bp)
Type: Others
Protein ID: WP_062955019.1
Type: Others
Protein ID: WP_062955019.1
Location: 2024588..2024926 (339 bp)
Type: Others
Protein ID: WP_002911404.1
Type: Others
Protein ID: WP_002911404.1
Location: 2025085..2025187 (103 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2026935..2027588 (654 bp)
Type: Others
Protein ID: WP_004180432.1
Type: Others
Protein ID: WP_004180432.1
Location: 2022243..2022902 (660 bp)
Type: Others
Protein ID: WP_002911407.1
Type: Others
Protein ID: WP_002911407.1
Location: 2022981..2023211 (231 bp)
Type: Others
Protein ID: WP_002911406.1
Type: Others
Protein ID: WP_002911406.1
Location: 2025049..2025194 (146 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2025562..2025705 (144 bp)
Type: Others
Protein ID: WP_002911398.1
Type: Others
Protein ID: WP_002911398.1
Location: 2025810..2026778 (969 bp)
Type: Others
Protein ID: WP_004151446.1
Type: Others
Protein ID: WP_004151446.1
Location: 2027585..2027776 (192 bp)
Type: Others
Protein ID: WP_002911395.1
Type: Others
Protein ID: WP_002911395.1
Location: 2027874..2028113 (240 bp)
Type: Others
Protein ID: WP_002911393.1
Type: Others
Protein ID: WP_002911393.1
Location: 2028229..2029662 (1434 bp)
Type: Others
Protein ID: WP_004148845.1
Type: Others
Protein ID: WP_004148845.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
C6M05_RS10145 | 2020179..2022239 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
C6M05_RS10150 | 2022243..2022902 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
C6M05_RS10155 | 2022981..2023211 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
C6M05_RS10160 | 2023324..2023698 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
C6M05_RS10165 | 2023702..2024571 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
C6M05_RS10170 | 2024588..2024926 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2025049..2025194 | - | 146 | - | - | Antitoxin |
- | 2025085..2025187 | + | 103 | - | - | Toxin |
C6M05_RS30360 | 2025562..2025705 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
C6M05_RS10180 | 2025810..2026778 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
C6M05_RS10185 | 2026935..2027588 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
C6M05_RS10190 | 2027585..2027776 | - | 192 | WP_002911395.1 | YebW family protein | - |
C6M05_RS10195 | 2027874..2028113 | - | 240 | WP_002911393.1 | YebV family protein | - |
C6M05_RS10200 | 2028229..2029662 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T119510 NZ_CP036305:2025085-2025187 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT119510 NZ_CP036305:c2025194-2025049 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT