Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1984706..1984849 | Replicon | chromosome |
Accession | NZ_CP034831 | ||
Organism | Salmonella sp. SSDFZ69 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1984744..1984847 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1984706..1984849 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
EOS98_RS09720 | 1981130..1981828 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
EOS98_RS09725 | 1981852..1982508 | - | 657 | WP_000100256.1 | carbon-nitrogen hydrolase family protein | - |
EOS98_RS09730 | 1982616..1982846 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
EOS98_RS09735 | 1982984..1983358 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
EOS98_RS09740 | 1983359..1984234 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
EOS98_RS09745 | 1984251..1984604 | + | 354 | WP_126524015.1 | YebY family protein | - |
- | 1984706..1984849 | - | 144 | - | - | Antitoxin |
- | 1984744..1984847 | + | 104 | - | - | Toxin |
EOS98_RS09750 | 1984978..1985628 | - | 651 | Protein_1832 | tyrosine-type recombinase/integrase | - |
EOS98_RS09755 | 1985651..1985944 | + | 294 | WP_001540231.1 | hypothetical protein | - |
EOS98_RS09760 | 1985883..1986869 | + | 987 | Protein_1834 | DUF1353 domain-containing protein | - |
EOS98_RS09765 | 1986918..1987027 | + | 110 | Protein_1835 | tail fiber assembly protein | - |
EOS98_RS09770 | 1987118..1987303 | - | 186 | WP_012218702.1 | hypothetical protein | - |
EOS98_RS09780 | 1987739..1988509 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
EOS98_RS09790 | 1988991..1989128 | + | 138 | Protein_1838 | helix-turn-helix domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1962834..2018424 | 55590 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T116893 NZ_CP034831:1984744-1984847 [Salmonella sp. SSDFZ69]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT116893 NZ_CP034831:c1984849-1984706 [Salmonella sp. SSDFZ69]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG