Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1514118..1514263 | Replicon | chromosome |
Accession | NZ_CP034408 | ||
Organism | Klebsiella pneumoniae strain NH34 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1514125..1514227 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1514118..1514263 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
EJC76_RS10005 | 1509649..1511082 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
EJC76_RS10010 | 1511198..1511437 | + | 240 | WP_002911393.1 | YebV family protein | - |
EJC76_RS10015 | 1511535..1511726 | + | 192 | WP_002911395.1 | YebW family protein | - |
EJC76_RS10020 | 1511723..1512376 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
EJC76_RS10025 | 1512533..1513501 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
EJC76_RS29655 | 1513606..1513749 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 1514118..1514263 | + | 146 | - | - | Antitoxin |
- | 1514125..1514227 | - | 103 | - | - | Toxin |
EJC76_RS10035 | 1514386..1514724 | - | 339 | WP_002911404.1 | YebY family protein | - |
EJC76_RS10040 | 1514741..1515610 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
EJC76_RS10045 | 1515614..1515988 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
EJC76_RS10050 | 1516101..1516331 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
EJC76_RS10055 | 1516410..1517069 | + | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
EJC76_RS10060 | 1517073..1519162 | - | 2090 | Protein_1500 | prolyl oligopeptidase family serine peptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T115948 NZ_CP034408:c1514227-1514125 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT115948 NZ_CP034408:1514118-1514263 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT