Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2036161..2036306 | Replicon | chromosome |
Accession | NZ_CP034039 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2036197..2036299 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2036161..2036306 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
C5X33_RS10175 | 2031291..2033351 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
C5X33_RS10180 | 2033355..2034014 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
C5X33_RS10185 | 2034093..2034323 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
C5X33_RS10190 | 2034436..2034810 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
C5X33_RS10195 | 2034814..2035683 | + | 870 | WP_019725445.1 | copper homeostasis membrane protein CopD | - |
C5X33_RS10200 | 2035700..2036038 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2036161..2036306 | - | 146 | - | - | Antitoxin |
- | 2036197..2036299 | + | 103 | - | - | Toxin |
C5X33_RS29590 | 2036674..2036817 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
C5X33_RS10210 | 2036922..2037890 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
C5X33_RS10215 | 2038047..2038700 | + | 654 | WP_019725444.1 | protein-serine/threonine phosphatase | - |
C5X33_RS10220 | 2038697..2038888 | - | 192 | WP_002911395.1 | YebW family protein | - |
C5X33_RS10225 | 2038986..2039225 | - | 240 | WP_002911393.1 | YebV family protein | - |
C5X33_RS10230 | 2039341..2040774 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T115025 NZ_CP034039:2036197-2036299 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT115025 NZ_CP034039:c2036306-2036161 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT