Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1970348..1970493 | Replicon | chromosome |
Accession | NZ_CP033946 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1970384..1970486 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1970348..1970493 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
EG819_RS09760 | 1965478..1967538 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
EG819_RS09765 | 1967542..1968201 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
EG819_RS09770 | 1968280..1968510 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
EG819_RS09775 | 1968623..1968997 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
EG819_RS09780 | 1969001..1969870 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
EG819_RS09785 | 1969887..1970225 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1970348..1970493 | - | 146 | - | - | Antitoxin |
- | 1970384..1970486 | + | 103 | - | - | Toxin |
EG819_RS28280 | 1970862..1971005 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
EG819_RS09795 | 1971110..1972078 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
EG819_RS09800 | 1972235..1972888 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
EG819_RS09805 | 1972885..1973076 | - | 192 | WP_002911395.1 | YebW family protein | - |
EG819_RS09810 | 1973174..1973413 | - | 240 | WP_002911393.1 | YebV family protein | - |
EG819_RS09815 | 1973529..1974962 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1899785..1987890 | 88105 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T114661 NZ_CP033946:1970384-1970486 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT114661 NZ_CP033946:c1970493-1970348 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT