Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3379616..3379756 | Replicon | chromosome |
Accession | NZ_CP033831 | ||
Organism | Serratia sp. FDAARGOS_506 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3379660..3379756 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3379616..3379756 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
EGY12_RS16395 | 3374814..3375239 | + | 426 | WP_123894631.1 | RNA polymerase-binding protein DksA | - |
EGY12_RS16400 | 3375434..3376387 | + | 954 | WP_123894632.1 | prolyl aminopeptidase | - |
EGY12_RS16405 | 3376421..3376651 | - | 231 | WP_033638067.1 | DNA polymerase III subunit theta | - |
EGY12_RS16410 | 3376996..3377514 | + | 519 | WP_123894633.1 | non-heme ferritin | - |
EGY12_RS16415 | 3377807..3378223 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
EGY12_RS16420 | 3378226..3379107 | + | 882 | WP_123894634.1 | copper homeostasis membrane protein CopD | - |
EGY12_RS16425 | 3379177..3379518 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 3379616..3379756 | - | 141 | - | - | Antitoxin |
- | 3379660..3379756 | + | 97 | - | - | Toxin |
EGY12_RS16430 | 3379835..3380916 | - | 1082 | Protein_3113 | phage integrase Arm DNA-binding domain-containing protein | - |
EGY12_RS16440 | 3380891..3381232 | - | 342 | WP_123894637.1 | excisionase | - |
EGY12_RS16445 | 3381323..3381478 | + | 156 | Protein_3115 | DUF1133 family protein | - |
EGY12_RS16450 | 3381579..3382202 | + | 624 | WP_123894638.1 | hypothetical protein | - |
EGY12_RS16455 | 3382289..3382540 | + | 252 | WP_123894639.1 | hypothetical protein | - |
EGY12_RS16460 | 3382561..3383055 | + | 495 | WP_123894640.1 | lysozyme | - |
EGY12_RS16465 | 3383052..3383438 | + | 387 | WP_123894641.1 | DUF2570 domain-containing protein | - |
EGY12_RS16470 | 3383674..3384069 | + | 396 | WP_123894642.1 | hypothetical protein | - |
EGY12_RS16475 | 3384066..3384377 | + | 312 | WP_123894643.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T114422 NZ_CP033831:3379660-3379756 [Serratia sp. FDAARGOS_506]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT114422 NZ_CP033831:c3379756-3379616 [Serratia sp. FDAARGOS_506]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG