Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1794022..1794131 | Replicon | chromosome |
Accession | NZ_CP033106 | ||
Organism | Pantoea sp. 201603H |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1794042..1794129 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1794022..1794131 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
EAE31_RS07990 | 1790735..1791394 | - | 660 | WP_154324858.1 | exodeoxyribonuclease X | - |
EAE31_RS07995 | 1791519..1791749 | - | 231 | WP_128174812.1 | DNA polymerase III subunit theta | - |
EAE31_RS08000 | 1791983..1792354 | + | 372 | WP_154324859.1 | CopC domain-containing protein YobA | - |
EAE31_RS08005 | 1792358..1793236 | + | 879 | WP_154324860.1 | copper homeostasis membrane protein CopD | - |
EAE31_RS08010 | 1793375..1793716 | + | 342 | WP_128174806.1 | YebY family protein | - |
- | 1794022..1794131 | - | 110 | - | - | Antitoxin |
- | 1794042..1794129 | + | 88 | - | - | Toxin |
EAE31_RS08015 | 1794206..1794475 | - | 270 | WP_154324861.1 | tyrosine-type recombinase/integrase | - |
EAE31_RS08020 | 1794532..1794936 | + | 405 | WP_154325567.1 | antitermination protein | - |
EAE31_RS08025 | 1794970..1795122 | - | 153 | WP_154324862.1 | transmembrane anchored protein | - |
EAE31_RS08030 | 1795671..1796093 | - | 423 | WP_154324863.1 | type II toxin-antitoxin system HicB family antitoxin | - |
EAE31_RS08035 | 1796140..1796322 | - | 183 | WP_154324864.1 | type II toxin-antitoxin system HicA family toxin | - |
EAE31_RS08040 | 1796556..1796765 | + | 210 | Protein_1564 | hypothetical protein | - |
EAE31_RS08045 | 1796839..1797219 | + | 381 | WP_154324865.1 | hypothetical protein | - |
EAE31_RS08050 | 1797542..1797985 | + | 444 | WP_154324866.1 | hypothetical protein | - |
EAE31_RS08055 | 1798337..1798711 | + | 375 | WP_154324867.1 | QacE | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1788670..1806541 | 17871 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 88 bp
>T113167 NZ_CP033106:1794042-1794129 [Pantoea sp. 201603H]
GCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTACCAAGAGCCATTCCCCTGGACCGAATACAGGAATCGTATTCGGT
CTTTTTTT
GCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTACCAAGAGCCATTCCCCTGGACCGAATACAGGAATCGTATTCGGT
CTTTTTTT
Antitoxin
Download Length: 110 bp
>AT113167 NZ_CP033106:c1794131-1794022 [Pantoea sp. 201603H]
ATAAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGGAATGGCTCTTGGTAGAGCCGTGCGCTAAAAGTTGGCAT
TAATGCAGGCGAGGTCGCCATGCCCTTTAA
ATAAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGGAATGGCTCTTGGTAGAGCCGTGCGCTAAAAGTTGGCAT
TAATGCAGGCGAGGTCGCCATGCCCTTTAA