Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 739667..739808 | Replicon | chromosome |
Accession | NZ_CP033076 | ||
Organism | Buttiauxella sp. 3AFRM03 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 739669..739773 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 739667..739808 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
D8682_RS04680 | 735264..735989 | - | 726 | WP_202914372.1 | hypothetical protein | - |
D8682_RS04685 | 735979..737181 | - | 1203 | Protein_708 | hypothetical protein | - |
D8682_RS04690 | 737203..737694 | + | 492 | WP_121813644.1 | hypothetical protein | - |
D8682_RS04695 | 737697..738044 | - | 348 | WP_121813645.1 | hypothetical protein | - |
D8682_RS04700 | 738041..738640 | - | 600 | WP_121813646.1 | phage baseplate protein | - |
D8682_RS04705 | 738755..739354 | - | 600 | WP_121815637.1 | lytic transglycosylase domain-containing protein | - |
D8682_RS04710 | 739269..739580 | + | 312 | WP_121813647.1 | tyrosine-type recombinase/integrase | - |
- | 739667..739808 | + | 142 | - | - | Antitoxin |
- | 739669..739773 | - | 105 | - | - | Toxin |
D8682_RS04715 | 739926..740267 | - | 342 | WP_064545927.1 | YebY family protein | - |
D8682_RS04720 | 740294..741166 | - | 873 | WP_064545924.1 | copper homeostasis membrane protein CopD | - |
D8682_RS04725 | 741172..741546 | - | 375 | WP_064545923.1 | CopC domain-containing protein YobA | - |
D8682_RS04730 | 741695..741925 | + | 231 | WP_034495983.1 | DNA polymerase III subunit theta | - |
D8682_RS04735 | 742057..742788 | + | 732 | WP_121813648.1 | carbon-nitrogen hydrolase family protein | - |
D8682_RS04740 | 742827..743489 | + | 663 | WP_064545921.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 105 bp
>T113051 NZ_CP033076:c739773-739669 [Buttiauxella sp. 3AFRM03]
GGCAAGGCGAAGTCTGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATA
TAGGAATCGTATTCGGTCTTTTTTT
GGCAAGGCGAAGTCTGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATA
TAGGAATCGTATTCGGTCTTTTTTT
Antitoxin
Download Length: 142 bp
>AT113051 NZ_CP033076:739667-739808 [Buttiauxella sp. 3AFRM03]
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCAGACTTCGCCTTGCCTTCTAAGAATAGTTTACCGGCGCAGCTTTTCCAGT
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCAGACTTCGCCTTGCCTTCTAAGAATAGTTTACCGGCGCAGCTTTTCCAGT