Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1942689..1942834 | Replicon | chromosome |
Accession | NZ_CP032831 | ||
Organism | Klebsiella pneumoniae strain INF078 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1942725..1942827 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1942689..1942834 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
D9K63_RS09585 | 1937819..1939879 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
D9K63_RS09590 | 1939883..1940542 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
D9K63_RS09595 | 1940621..1940851 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
D9K63_RS09600 | 1940964..1941338 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
D9K63_RS09605 | 1941342..1942211 | + | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
D9K63_RS09610 | 1942228..1942566 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1942689..1942834 | - | 146 | - | - | Antitoxin |
- | 1942725..1942827 | + | 103 | - | - | Toxin |
D9K63_RS28815 | 1943202..1943345 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
D9K63_RS09620 | 1943450..1944418 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
D9K63_RS09625 | 1944575..1945228 | + | 654 | WP_009307541.1 | protein-serine/threonine phosphatase | - |
D9K63_RS09630 | 1945225..1945416 | - | 192 | WP_002911395.1 | YebW family protein | - |
D9K63_RS09635 | 1945514..1945753 | - | 240 | WP_002911393.1 | YebV family protein | - |
D9K63_RS09640 | 1945869..1947302 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1870023..1960230 | 90207 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T112603 NZ_CP032831:1942725-1942827 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT112603 NZ_CP032831:c1942834-1942689 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT