Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1509578..1509674 | Replicon | chromosome |
Accession | NZ_CP032487 | ||
Organism | Yersinia hibernica strain CFS1934 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1509578..1509670 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1509578..1509674 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
D5F51_RS06985 | 1505162..1506118 | + | 957 | WP_129195982.1 | prolyl aminopeptidase | - |
D5F51_RS06990 | 1506167..1506400 | - | 234 | WP_025378527.1 | DNA polymerase III subunit theta | - |
D5F51_RS06995 | 1506795..1507304 | + | 510 | WP_025378526.1 | non-heme ferritin | - |
D5F51_RS07000 | 1507696..1508082 | + | 387 | WP_129195983.1 | CopC domain-containing protein YobA | - |
D5F51_RS07005 | 1508084..1508968 | + | 885 | WP_129195984.1 | copper homeostasis membrane protein CopD | - |
D5F51_RS07010 | 1509065..1509406 | + | 342 | WP_129199241.1 | YebY family protein | - |
- | 1509578..1509670 | + | 93 | - | - | Toxin |
- | 1509578..1509674 | - | 97 | - | - | Antitoxin |
D5F51_RS07015 | 1509749..1510831 | - | 1083 | WP_129195985.1 | phage integrase Arm DNA-binding domain-containing protein | - |
D5F51_RS07020 | 1510806..1511072 | - | 267 | WP_025378521.1 | excisionase | - |
D5F51_RS07025 | 1511145..1511657 | - | 513 | WP_025378520.1 | siphovirus Gp157 family protein | - |
D5F51_RS07030 | 1511654..1513807 | - | 2154 | WP_129195986.1 | hypothetical protein | - |
D5F51_RS07035 | 1513821..1514135 | - | 315 | WP_042546155.1 | hypothetical protein | - |
D5F51_RS07040 | 1514324..1514656 | - | 333 | WP_061111990.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1506167..1571241 | 65074 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 93 bp
>T111844 NZ_CP032487:1509578-1509670 [Yersinia hibernica]
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
Antitoxin
Download Length: 97 bp
>AT111844 NZ_CP032487:c1509674-1509578 [Yersinia hibernica]
AGTTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAACGTAGGCTTA
AGTTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAACGTAGGCTTA