Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 31556..31701 | Replicon | chromosome |
Accession | NZ_CP032207 | ||
Organism | Klebsiella pneumoniae strain AR_0109 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 31563..31665 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 31556..31701 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM488_RS00390 | 27437..27676 | + | 240 | WP_002911393.1 | YebV family protein | - |
AM488_RS00395 | 27774..27965 | + | 192 | WP_002911395.1 | YebW family protein | - |
AM488_RS00400 | 27962..28615 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
AM488_RS00405 | 28772..29740 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
AM488_RS30510 | 29845..29988 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
AM488_RS00410 | 30267..31247 | - | 981 | WP_000019473.1 | IS5-like element ISKpn26 family transposase | - |
- | 31556..31701 | + | 146 | - | - | Antitoxin |
- | 31563..31665 | - | 103 | - | - | Toxin |
AM488_RS00420 | 31824..32162 | - | 339 | WP_016529031.1 | YebY family protein | - |
AM488_RS00425 | 32179..33048 | - | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
AM488_RS00430 | 33052..33426 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
AM488_RS00435 | 33539..33769 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AM488_RS00440 | 33848..34507 | + | 660 | WP_032425085.1 | exodeoxyribonuclease X | - |
AM488_RS00445 | 34511..36571 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 30267..31247 | 980 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T111379 NZ_CP032207:c31665-31563 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT111379 NZ_CP032207:31556-31701 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT