Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1565442..1565587 | Replicon | chromosome |
Accession | NZ_CP032167 | ||
Organism | Klebsiella pneumoniae strain AR_0076 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1565478..1565580 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1565442..1565587 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM455_RS08125 | 1560572..1562632 | + | 2061 | WP_119177255.1 | oligopeptidase B | - |
AM455_RS08130 | 1562636..1563295 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
AM455_RS08135 | 1563374..1563604 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AM455_RS08140 | 1563717..1564091 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
AM455_RS08145 | 1564095..1564964 | + | 870 | WP_023280292.1 | copper homeostasis membrane protein CopD | - |
AM455_RS08150 | 1564981..1565319 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1565442..1565587 | - | 146 | - | - | Antitoxin |
- | 1565478..1565580 | + | 103 | - | - | Toxin |
AM455_RS29060 | 1565956..1566099 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
AM455_RS08160 | 1566204..1567172 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
AM455_RS08165 | 1567329..1567982 | + | 654 | WP_023280291.1 | protein-serine/threonine phosphatase | - |
AM455_RS08170 | 1567979..1568170 | - | 192 | WP_002911395.1 | YebW family protein | - |
AM455_RS08175 | 1568268..1568507 | - | 240 | WP_002911393.1 | YebV family protein | - |
AM455_RS08180 | 1568623..1570056 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1491850..1572813 | 80963 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T111212 NZ_CP032167:1565478-1565580 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT111212 NZ_CP032167:c1565587-1565442 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT