Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1971201..1971346 | Replicon | chromosome |
Accession | NZ_CP031885 | ||
Organism | Klebsiella pneumoniae strain WCHKP095845 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1971237..1971339 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1971201..1971346 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
BT110_RS11435 | 1966331..1968391 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
BT110_RS11440 | 1968395..1969054 | - | 660 | WP_021440386.1 | exodeoxyribonuclease X | - |
BT110_RS11445 | 1969133..1969363 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
BT110_RS11450 | 1969476..1969850 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
BT110_RS11455 | 1969854..1970723 | + | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
BT110_RS11460 | 1970740..1971078 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1971201..1971346 | - | 146 | - | - | Antitoxin |
- | 1971237..1971339 | + | 103 | - | - | Toxin |
BT110_RS28035 | 1971715..1971858 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
BT110_RS11470 | 1971963..1972931 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
BT110_RS11475 | 1973088..1973741 | + | 654 | WP_009484457.1 | protein-serine/threonine phosphatase | - |
BT110_RS11480 | 1973738..1973929 | - | 192 | WP_002911395.1 | YebW family protein | - |
BT110_RS11485 | 1974027..1974266 | - | 240 | WP_002911393.1 | YebV family protein | - |
BT110_RS11490 | 1974382..1975815 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1906400..1978572 | 72172 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T110471 NZ_CP031885:1971237-1971339 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT110471 NZ_CP031885:c1971346-1971201 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT