Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1892733..1892878 | Replicon | chromosome |
Accession | NZ_CP031798 | ||
Organism | Klebsiella pneumoniae strain QMP B2-170 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1892769..1892871 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1892733..1892878 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
D0900_RS09545 | 1887864..1889924 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
D0900_RS09550 | 1889928..1890587 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
D0900_RS09555 | 1890666..1890896 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
D0900_RS09560 | 1891009..1891383 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
D0900_RS09565 | 1891387..1892256 | + | 870 | WP_049181704.1 | copper homeostasis membrane protein CopD | - |
D0900_RS09570 | 1892273..1892611 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1892733..1892878 | - | 146 | - | - | Antitoxin |
- | 1892769..1892871 | + | 103 | - | - | Toxin |
D0900_RS27610 | 1893247..1893390 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
D0900_RS09580 | 1893495..1894463 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
D0900_RS09585 | 1894620..1895273 | + | 654 | WP_023280291.1 | protein-serine/threonine phosphatase | - |
D0900_RS09590 | 1895270..1895461 | - | 192 | WP_002911395.1 | YebW family protein | - |
D0900_RS09595 | 1895559..1895798 | - | 240 | WP_002911393.1 | YebV family protein | - |
D0900_RS09600 | 1895914..1897347 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T110143 NZ_CP031798:1892769-1892871 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT110143 NZ_CP031798:c1892878-1892733 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT