Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1453307..1453425 | Replicon | chromosome |
Accession | NZ_CP030980 | ||
Organism | Yersinia enterocolitica subsp. palearctica strain Y1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1453329..1453423 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1453307..1453425 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
YEY1_RS06695 | 1448922..1449878 | + | 957 | WP_005163605.1 | prolyl aminopeptidase | - |
YEY1_RS06700 | 1449928..1450161 | - | 234 | WP_004389928.1 | DNA polymerase III subunit theta | - |
YEY1_RS06705 | 1450544..1451053 | + | 510 | WP_005163604.1 | non-heme ferritin | - |
YEY1_RS06710 | 1451444..1451830 | + | 387 | WP_005163603.1 | CopC domain-containing protein YobA | - |
YEY1_RS06715 | 1451832..1452716 | + | 885 | WP_005163602.1 | copper homeostasis membrane protein CopD | - |
YEY1_RS06720 | 1452813..1453154 | + | 342 | WP_005163587.1 | YebY family protein | - |
- | 1453307..1453425 | - | 119 | - | - | Antitoxin |
- | 1453329..1453423 | + | 95 | - | - | Toxin |
YEY1_RS06725 | 1453481..1454551 | - | 1071 | WP_023161015.1 | tyrosine-type recombinase/integrase | - |
YEY1_RS06730 | 1454792..1455607 | + | 816 | WP_005163581.1 | hypothetical protein | - |
YEY1_RS06735 | 1455692..1455913 | - | 222 | WP_005163580.1 | DNA-binding transcriptional regulator | - |
YEY1_RS06740 | 1456006..1457148 | - | 1143 | WP_005163579.1 | phage late control D family protein | - |
YEY1_RS06745 | 1457145..1457597 | - | 453 | WP_005163578.1 | phage tail protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1447750..1462768 | 15018 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 95 bp
>T108277 NZ_CP030980:1453329-1453423 [Yersinia enterocolitica subsp. palearctica]
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTTTTTTT
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTTTTTTT
Antitoxin
Download Length: 119 bp
>AT108277 NZ_CP030980:c1453425-1453307 [Yersinia enterocolitica subsp. palearctica]
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG