Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3255879..3256024 | Replicon | chromosome |
Accession | NZ_CP030923 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3255915..3256017 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3255879..3256024 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DTN91_RS16215 | 3251009..3253069 | + | 2061 | WP_004899137.1 | oligopeptidase B | - |
DTN91_RS16220 | 3253073..3253732 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
DTN91_RS16225 | 3253811..3254041 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
DTN91_RS16230 | 3254154..3254528 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
DTN91_RS16235 | 3254532..3255401 | + | 870 | WP_004899136.1 | copper homeostasis membrane protein CopD | - |
DTN91_RS16240 | 3255418..3255756 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 3255879..3256024 | - | 146 | - | - | Antitoxin |
- | 3255915..3256017 | + | 103 | - | - | Toxin |
DTN91_RS28100 | 3256392..3256535 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
DTN91_RS16250 | 3256640..3257608 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
DTN91_RS16255 | 3257765..3258418 | + | 654 | WP_004891053.1 | protein-serine/threonine phosphatase | - |
DTN91_RS16260 | 3258415..3258606 | - | 192 | WP_002911395.1 | YebW family protein | - |
DTN91_RS16265 | 3258704..3258943 | - | 240 | WP_002911393.1 | YebV family protein | - |
DTN91_RS16270 | 3259059..3260492 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T108209 NZ_CP030923:3255915-3256017 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT108209 NZ_CP030923:c3256024-3255879 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT