Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2072722..2072867 | Replicon | chromosome |
Accession | NZ_CP030300 | ||
Organism | Klebsiella pneumoniae strain 283747 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2072758..2072860 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2072722..2072867 (-) |
Genomic Context
Location: 2067852..2069912 (2061 bp)
Type: Others
Protein ID: WP_004151449.1
Type: Others
Protein ID: WP_004151449.1
Location: 2070997..2071371 (375 bp)
Type: Others
Protein ID: WP_004151448.1
Type: Others
Protein ID: WP_004151448.1
Location: 2071375..2072244 (870 bp)
Type: Others
Protein ID: WP_062955019.1
Type: Others
Protein ID: WP_062955019.1
Location: 2072261..2072599 (339 bp)
Type: Others
Protein ID: WP_002911404.1
Type: Others
Protein ID: WP_002911404.1
Location: 2072758..2072860 (103 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2074608..2075261 (654 bp)
Type: Others
Protein ID: WP_004180432.1
Type: Others
Protein ID: WP_004180432.1
Location: 2069916..2070575 (660 bp)
Type: Others
Protein ID: WP_002911407.1
Type: Others
Protein ID: WP_002911407.1
Location: 2070654..2070884 (231 bp)
Type: Others
Protein ID: WP_002911406.1
Type: Others
Protein ID: WP_002911406.1
Location: 2072722..2072867 (146 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2073235..2073378 (144 bp)
Type: Others
Protein ID: WP_002911398.1
Type: Others
Protein ID: WP_002911398.1
Location: 2073483..2074451 (969 bp)
Type: Others
Protein ID: WP_004151446.1
Type: Others
Protein ID: WP_004151446.1
Location: 2075258..2075449 (192 bp)
Type: Others
Protein ID: WP_002911395.1
Type: Others
Protein ID: WP_002911395.1
Location: 2075547..2075786 (240 bp)
Type: Others
Protein ID: WP_002911393.1
Type: Others
Protein ID: WP_002911393.1
Location: 2075902..2077335 (1434 bp)
Type: Others
Protein ID: WP_004148845.1
Type: Others
Protein ID: WP_004148845.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DRB02_RS10205 (DRB02_10540) | 2067852..2069912 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
DRB02_RS10210 (DRB02_10545) | 2069916..2070575 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
DRB02_RS10215 (DRB02_10550) | 2070654..2070884 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
DRB02_RS10220 (DRB02_10555) | 2070997..2071371 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
DRB02_RS10225 (DRB02_10560) | 2071375..2072244 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
DRB02_RS10230 (DRB02_10565) | 2072261..2072599 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2072722..2072867 | - | 146 | - | - | Antitoxin |
- | 2072758..2072860 | + | 103 | - | - | Toxin |
DRB02_RS10235 | 2073235..2073378 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
DRB02_RS10240 (DRB02_10575) | 2073483..2074451 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
DRB02_RS10245 (DRB02_10580) | 2074608..2075261 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
DRB02_RS10250 (DRB02_10585) | 2075258..2075449 | - | 192 | WP_002911395.1 | YebW family protein | - |
DRB02_RS10255 (DRB02_10590) | 2075547..2075786 | - | 240 | WP_002911393.1 | YebV family protein | - |
DRB02_RS10260 (DRB02_10595) | 2075902..2077335 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T107540 NZ_CP030300:2072758-2072860 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT107540 NZ_CP030300:c2072867-2072722 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT