Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3489346..3489491 | Replicon | chromosome |
Accession | NZ_CP030174 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain 11219 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3489353..3489455 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3489346..3489491 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DQB71_RS17790 | 3484878..3486311 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
DQB71_RS17795 | 3486427..3486666 | + | 240 | WP_002911393.1 | YebV family protein | - |
DQB71_RS17800 | 3486764..3486955 | + | 192 | WP_002911395.1 | YebW family protein | - |
DQB71_RS17805 | 3486952..3487605 | - | 654 | WP_020802220.1 | protein-serine/threonine phosphatase | - |
DQB71_RS17810 | 3487762..3488730 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
DQB71_RS27440 | 3488835..3488978 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3489346..3489491 | + | 146 | - | - | Antitoxin |
- | 3489353..3489455 | - | 103 | - | - | Toxin |
DQB71_RS17820 | 3489614..3489952 | - | 339 | WP_002911404.1 | YebY family protein | - |
DQB71_RS17825 | 3489969..3490838 | - | 870 | WP_112162692.1 | copper homeostasis membrane protein CopD | - |
DQB71_RS17830 | 3490842..3491216 | - | 375 | WP_112162694.1 | CopC domain-containing protein YobA | - |
DQB71_RS17835 | 3491329..3491559 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
DQB71_RS17840 | 3491638..3492297 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
DQB71_RS17845 | 3492301..3494361 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T107320 NZ_CP030174:c3489455-3489353 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT107320 NZ_CP030174:3489346-3489491 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT