Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2024611..2024755 | Replicon | chromosome |
Accession | NZ_CP030173 | ||
Organism | Klebsiella variicola strain 13450 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2024647..2024749 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2024611..2024755 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DQB70_RS10135 | 2020467..2021126 | - | 660 | WP_022066251.1 | exodeoxyribonuclease X | - |
DQB70_RS10140 | 2021205..2021435 | - | 231 | WP_012541260.1 | DNA polymerase III subunit theta | - |
DQB70_RS10145 | 2021549..2021923 | + | 375 | WP_008804269.1 | CopC domain-containing protein YobA | - |
DQB70_RS10150 | 2021927..2022796 | + | 870 | WP_012541262.1 | copper homeostasis membrane protein CopD | - |
DQB70_RS10155 | 2022813..2023187 | + | 375 | WP_181646003.1 | YebY family protein | - |
DQB70_RS10165 | 2023257..2024465 | + | 1209 | WP_001352368.1 | IS4-like element ISVsa5 family transposase | - |
- | 2024611..2024755 | - | 145 | - | - | Antitoxin |
- | 2024647..2024749 | + | 103 | - | - | Toxin |
DQB70_RS27540 | 2025134..2025277 | - | 144 | WP_046621074.1 | Ecr family regulatory small membrane protein | - |
DQB70_RS10175 | 2025381..2026370 | - | 990 | WP_032691211.1 | VirK/YbjX family protein | - |
DQB70_RS10180 | 2026506..2027159 | + | 654 | WP_022066249.1 | protein-serine/threonine phosphatase | - |
DQB70_RS10185 | 2027156..2027347 | - | 192 | WP_002911395.1 | YebW family protein | - |
DQB70_RS10190 | 2027445..2027684 | - | 240 | WP_002911393.1 | YebV family protein | - |
DQB70_RS10195 | 2027800..2029233 | - | 1434 | WP_012967754.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 2023257..2024465 | 1208 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T107298 NZ_CP030173:2024647-2024749 [Klebsiella variicola]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT107298 NZ_CP030173:c2024755-2024611 [Klebsiella variicola]
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT