Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1881665..1881810 | Replicon | chromosome |
Accession | NZ_CP030172 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain 12208 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1881701..1881803 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1881665..1881810 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DQB68_RS09295 | 1876795..1878855 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
DQB68_RS09300 | 1878859..1879518 | - | 660 | WP_021440386.1 | exodeoxyribonuclease X | - |
DQB68_RS09305 | 1879597..1879827 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
DQB68_RS09310 | 1879940..1880314 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
DQB68_RS09315 | 1880318..1881187 | + | 870 | WP_021440385.1 | copper homeostasis membrane protein CopD | - |
DQB68_RS09320 | 1881204..1881542 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1881665..1881810 | - | 146 | - | - | Antitoxin |
- | 1881701..1881803 | + | 103 | - | - | Toxin |
DQB68_RS26205 | 1882179..1882322 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
DQB68_RS09330 | 1882427..1883395 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
DQB68_RS09335 | 1883552..1884205 | + | 654 | WP_021440384.1 | protein-serine/threonine phosphatase | - |
DQB68_RS09340 | 1884202..1884393 | - | 192 | WP_002911395.1 | YebW family protein | - |
DQB68_RS09345 | 1884491..1884730 | - | 240 | WP_002911393.1 | YebV family protein | - |
DQB68_RS09350 | 1884846..1886279 | - | 1434 | WP_021440382.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T107278 NZ_CP030172:1881701-1881803 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT107278 NZ_CP030172:c1881810-1881665 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT