Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2011918..2012065 | Replicon | chromosome |
Accession | NZ_CP030171 | ||
Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2011959..2012061 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2011918..2012065 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DP204_RS10150 | 2007053..2009113 | + | 2061 | WP_112201428.1 | oligopeptidase B | - |
DP204_RS10155 | 2009117..2009776 | - | 660 | WP_023290237.1 | exodeoxyribonuclease X | - |
DP204_RS10160 | 2009855..2010085 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
DP204_RS10165 | 2010198..2010572 | + | 375 | WP_032453372.1 | CopC domain-containing protein YobA | - |
DP204_RS10170 | 2010576..2011445 | + | 870 | WP_050533810.1 | copper homeostasis membrane protein CopD | - |
DP204_RS10175 | 2011462..2011800 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2011918..2012065 | - | 148 | - | - | Antitoxin |
- | 2011959..2012061 | + | 103 | - | - | Toxin |
DP204_RS27765 | 2012440..2012583 | - | 144 | WP_032425946.1 | Ecr family regulatory small membrane protein | - |
DP204_RS10185 | 2012688..2013656 | - | 969 | WP_181573388.1 | VirK/YbjX family protein | - |
DP204_RS10190 | 2013813..2014466 | + | 654 | WP_023290232.1 | protein-serine/threonine phosphatase | - |
DP204_RS10195 | 2014463..2014654 | - | 192 | WP_002911395.1 | YebW family protein | - |
DP204_RS10200 | 2014752..2014991 | - | 240 | WP_002911393.1 | YebV family protein | - |
DP204_RS10205 | 2015107..2016537 | - | 1431 | WP_112201429.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T107264 NZ_CP030171:2011959-2012061 [Klebsiella quasipneumoniae subsp. quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 148 bp
>AT107264 NZ_CP030171:c2012065-2011918 [Klebsiella quasipneumoniae subsp. quasipneumoniae]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG