Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 4650807..4650947 | Replicon | chromosome |
Accession | NZ_CP029746 | ||
Organism | Serratia marcescens strain AR_0122 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 4650851..4650947 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 4650807..4650947 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM369_RS22045 | 4646007..4646432 | + | 426 | WP_033638066.1 | RNA polymerase-binding protein DksA | - |
AM369_RS22050 | 4646625..4647578 | + | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
AM369_RS22055 | 4647610..4647840 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
AM369_RS22060 | 4648186..4648704 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
AM369_RS22065 | 4648998..4649414 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
AM369_RS22070 | 4649417..4650298 | + | 882 | WP_033646425.1 | copper homeostasis membrane protein CopD | - |
AM369_RS22075 | 4650368..4650709 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 4650807..4650947 | - | 141 | - | - | Antitoxin |
- | 4650851..4650947 | + | 97 | - | - | Toxin |
AM369_RS22080 | 4651200..4651604 | + | 405 | WP_033646424.1 | hypothetical protein | - |
AM369_RS22085 | 4651601..4651819 | - | 219 | WP_033638114.1 | hypothetical protein | - |
AM369_RS24535 | 4651883..4652047 | - | 165 | WP_154067227.1 | hypothetical protein | - |
AM369_RS22090 | 4652339..4652689 | + | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
AM369_RS22095 | 4652873..4654072 | + | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
AM369_RS22100 | 4654300..4654518 | + | 219 | WP_033646423.1 | hypothetical protein | - |
AM369_RS22105 | 4654690..4654995 | + | 306 | WP_033646422.1 | hypothetical protein | - |
AM369_RS22110 | 4655039..4655374 | + | 336 | WP_033638120.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T106659 NZ_CP029746:4650851-4650947 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT106659 NZ_CP029746:c4650947-4650807 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG