Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 4085834..4085981 | Replicon | chromosome |
Accession | NZ_CP029597 | ||
Organism | Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 4085875..4085977 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 4085834..4085981 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DLJ73_RS20450 | 4080969..4083029 | + | 2061 | WP_004203388.1 | oligopeptidase B | - |
DLJ73_RS20455 | 4083033..4083692 | - | 660 | WP_004203387.1 | exodeoxyribonuclease X | - |
DLJ73_RS20460 | 4083771..4084001 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
DLJ73_RS20465 | 4084114..4084488 | + | 375 | WP_004203386.1 | CopC domain-containing protein YobA | - |
DLJ73_RS20470 | 4084492..4085361 | + | 870 | WP_004203385.1 | copper homeostasis membrane protein CopD | - |
DLJ73_RS20475 | 4085378..4085716 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 4085834..4085981 | - | 148 | - | - | Antitoxin |
- | 4085875..4085977 | + | 103 | - | - | Toxin |
DLJ73_RS28400 | 4086365..4086508 | - | 144 | WP_032425946.1 | Ecr family regulatory small membrane protein | - |
DLJ73_RS20485 | 4086612..4087580 | - | 969 | WP_004203383.1 | VirK/YbjX family protein | - |
DLJ73_RS20490 | 4087737..4088390 | + | 654 | WP_004203382.1 | protein-serine/threonine phosphatase | - |
DLJ73_RS20495 | 4088387..4088578 | - | 192 | WP_002911395.1 | YebW family protein | - |
DLJ73_RS20500 | 4088676..4088915 | - | 240 | WP_002911393.1 | YebV family protein | - |
DLJ73_RS20505 | 4089032..4090465 | - | 1434 | WP_004203381.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T105978 NZ_CP029597:4085875-4085977 [Klebsiella quasipneumoniae subsp. similipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 148 bp
>AT105978 NZ_CP029597:c4085981-4085834 [Klebsiella quasipneumoniae subsp. similipneumoniae]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG