Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1497261..1497406 | Replicon | chromosome |
Accession | NZ_CP029388 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1497268..1497370 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1497261..1497406 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CVG30_RS09385 | 1492794..1494227 | + | 1434 | WP_032415191.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
CVG30_RS09390 | 1494343..1494582 | + | 240 | WP_002911393.1 | YebV family protein | - |
CVG30_RS09395 | 1494680..1494871 | + | 192 | WP_002911395.1 | YebW family protein | - |
CVG30_RS09400 | 1494868..1495521 | - | 654 | WP_009484457.1 | protein-serine/threonine phosphatase | - |
CVG30_RS09405 | 1495678..1496645 | + | 968 | Protein_1502 | DUF535 domain-containing protein | - |
CVG30_RS28665 | 1496750..1496893 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 1497261..1497406 | + | 146 | - | - | Antitoxin |
- | 1497268..1497370 | - | 103 | - | - | Toxin |
CVG30_RS09415 | 1497529..1497867 | - | 339 | WP_002911404.1 | YebY family protein | - |
CVG30_RS09420 | 1497884..1498753 | - | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
CVG30_RS09425 | 1498757..1499131 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CVG30_RS09430 | 1499244..1499474 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CVG30_RS09435 | 1499553..1500212 | + | 660 | WP_021440386.1 | exodeoxyribonuclease X | - |
CVG30_RS09440 | 1500216..1502276 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T105578 NZ_CP029388:c1497370-1497268 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT105578 NZ_CP029388:1497261-1497406 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT