Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 386653..386793 | Replicon | chromosome |
Accession | NZ_CP028949 | ||
Organism | Serratia marcescens strain AR_0121 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 386653..386749 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 386653..386793 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM368_RS01790 | 382226..382561 | - | 336 | WP_033638120.1 | hypothetical protein | - |
AM368_RS01795 | 382605..382910 | - | 306 | WP_033646422.1 | hypothetical protein | - |
AM368_RS01800 | 383082..383300 | - | 219 | WP_033646423.1 | hypothetical protein | - |
AM368_RS01805 | 383528..384727 | - | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
AM368_RS01810 | 384911..385261 | - | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
AM368_RS24415 | 385553..385717 | + | 165 | WP_154067227.1 | hypothetical protein | - |
AM368_RS01815 | 385781..385999 | + | 219 | WP_033638114.1 | hypothetical protein | - |
AM368_RS01820 | 385996..386400 | - | 405 | WP_033646424.1 | hypothetical protein | - |
- | 386653..386749 | - | 97 | - | - | Toxin |
- | 386653..386793 | + | 141 | - | - | Antitoxin |
AM368_RS01825 | 386891..387232 | - | 342 | WP_025302452.1 | YebY family protein | - |
AM368_RS01830 | 387302..388183 | - | 882 | WP_033646425.1 | copper homeostasis membrane protein CopD | - |
AM368_RS01835 | 388186..388602 | - | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
AM368_RS01840 | 388896..389414 | - | 519 | WP_025302449.1 | non-heme ferritin | - |
AM368_RS01845 | 389760..389990 | + | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
AM368_RS01850 | 390022..390975 | - | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
AM368_RS01855 | 391168..391593 | - | 426 | WP_033638066.1 | RNA polymerase-binding protein DksA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T104452 NZ_CP028949:c386749-386653 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT104452 NZ_CP028949:386653-386793 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG