Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 4627460..4627600 | Replicon | chromosome |
Accession | NZ_CP028948 | ||
Organism | Serratia marcescens strain AR_0123 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 4627460..4627556 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 4627460..4627600 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM370_RS21905 | 4623033..4623368 | - | 336 | WP_033638120.1 | hypothetical protein | - |
AM370_RS21910 | 4623412..4623717 | - | 306 | WP_033646422.1 | hypothetical protein | - |
AM370_RS21915 | 4623889..4624107 | - | 219 | WP_033646423.1 | hypothetical protein | - |
AM370_RS21920 | 4624335..4625534 | - | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
AM370_RS21925 | 4625718..4626068 | - | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
AM370_RS24515 | 4626360..4626524 | + | 165 | WP_154067227.1 | hypothetical protein | - |
AM370_RS21930 | 4626588..4626806 | + | 219 | WP_033638114.1 | hypothetical protein | - |
AM370_RS21935 | 4626803..4627207 | - | 405 | WP_033646424.1 | hypothetical protein | - |
- | 4627460..4627556 | - | 97 | - | - | Toxin |
- | 4627460..4627600 | + | 141 | - | - | Antitoxin |
AM370_RS21940 | 4627698..4628039 | - | 342 | WP_025302452.1 | YebY family protein | - |
AM370_RS21945 | 4628109..4628990 | - | 882 | WP_033646425.1 | copper homeostasis membrane protein CopD | - |
AM370_RS21950 | 4628993..4629409 | - | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
AM370_RS21955 | 4629703..4630221 | - | 519 | WP_025302449.1 | non-heme ferritin | - |
AM370_RS21960 | 4630567..4630797 | + | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
AM370_RS21965 | 4630829..4631782 | - | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
AM370_RS21970 | 4631975..4632400 | - | 426 | WP_033638066.1 | RNA polymerase-binding protein DksA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T104442 NZ_CP028948:c4627556-4627460 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT104442 NZ_CP028948:4627460-4627600 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG