Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3609975..3610115 | Replicon | chromosome |
Accession | NZ_CP028946 | ||
Organism | Serratia marcescens strain AR_0124 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3610019..3610115 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3609975..3610115 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM371_RS17145 | 3605175..3605600 | + | 426 | WP_033638066.1 | RNA polymerase-binding protein DksA | - |
AM371_RS17150 | 3605793..3606746 | + | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
AM371_RS17155 | 3606778..3607008 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
AM371_RS17160 | 3607354..3607872 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
AM371_RS17165 | 3608166..3608582 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
AM371_RS17170 | 3608585..3609466 | + | 882 | WP_033646425.1 | copper homeostasis membrane protein CopD | - |
AM371_RS17175 | 3609536..3609877 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 3609975..3610115 | - | 141 | - | - | Antitoxin |
- | 3610019..3610115 | + | 97 | - | - | Toxin |
AM371_RS17180 | 3610368..3610772 | + | 405 | WP_033646424.1 | hypothetical protein | - |
AM371_RS17185 | 3610769..3610987 | - | 219 | WP_033638114.1 | hypothetical protein | - |
AM371_RS24740 | 3611051..3611215 | - | 165 | WP_154067227.1 | hypothetical protein | - |
AM371_RS17190 | 3611507..3611857 | + | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
AM371_RS17195 | 3612041..3613240 | + | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
AM371_RS17200 | 3613468..3613686 | + | 219 | WP_033646423.1 | hypothetical protein | - |
AM371_RS17205 | 3613858..3614163 | + | 306 | WP_033646422.1 | hypothetical protein | - |
AM371_RS17210 | 3614207..3614542 | + | 336 | WP_033638120.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T104423 NZ_CP028946:3610019-3610115 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT104423 NZ_CP028946:c3610115-3609975 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG