Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1925716..1925860 | Replicon | chromosome |
Accession | NZ_CP028783 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1925752..1925854 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1925716..1925860 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CLQ69_RS11170 | 1920846..1922906 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
CLQ69_RS11175 | 1922910..1923569 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
CLQ69_RS11180 | 1923648..1923878 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CLQ69_RS11185 | 1923991..1924365 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CLQ69_RS11190 | 1924369..1925238 | + | 870 | WP_020956678.1 | copper homeostasis membrane protein CopD | - |
CLQ69_RS11195 | 1925252..1925593 | + | 342 | WP_015874944.1 | YebY family protein | - |
- | 1925716..1925860 | - | 145 | - | - | Antitoxin |
- | 1925752..1925854 | + | 103 | - | - | Toxin |
CLQ69_RS11200 | 1925987..1926346 | - | 360 | WP_077253379.1 | tyrosine-type recombinase/integrase | - |
CLQ69_RS11205 | 1926345..1926824 | + | 480 | WP_032419797.1 | lysis protein | - |
CLQ69_RS11210 | 1927279..1927474 | + | 196 | Protein_1904 | DNA polymerase V | - |
CLQ69_RS11215 | 1927613..1929118 | + | 1506 | WP_020956680.1 | hypothetical protein | - |
CLQ69_RS11220 | 1929368..1929796 | - | 429 | WP_032419788.1 | type II toxin-antitoxin system PemK/MazF family toxin | - |
CLQ69_RS11225 | 1929806..1930087 | - | 282 | WP_032419786.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T104113 NZ_CP028783:1925752-1925854 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT104113 NZ_CP028783:c1925860-1925716 [Klebsiella pneumoniae subsp. pneumoniae]
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT