Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | creTA/- |
| Location | 142510..142745 | Replicon | plasmid pSTJ001 |
| Accession | NZ_LN831303 | ||
| Organism | Halobacterium hubeiense strain JI20-1 | ||
Toxin (RNA)
| Gene name | creT | ||
| Locus tag | - | ||
| Coordinates | 142672..142745 (-) |
Antitoxin (RNA)
| Gene name | creA | ||
| Locus tag | - | ||
| Coordinates | 142510..142567 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HHUB_RS13850 (HHUB_4142) | 137576..138367 | - | 792 | WP_059058535.1 | type I-B CRISPR-associated protein Cas5b | - |
| HHUB_RS13855 (HHUB_4143) | 138367..139485 | - | 1119 | WP_059058536.1 | type I-B CRISPR-associated protein Cas7/Csh2 | - |
| HHUB_RS13860 (HHUB_4144) | 139482..141629 | - | 2148 | WP_059058537.1 | type I-B CRISPR-associated protein Cas8b/Csh1 | - |
| HHUB_RS13865 (HHUB_4145) | 141626..142432 | - | 807 | WP_082687269.1 | CRISPR-associated endoribonuclease Cas6 | - |
| - | 142510..142567 | - | 58 | - | - | Antitoxin |
| - | 142672..142745 | - | 74 | - | - | Toxin |
| HHUB_RS13870 (HHUB_4147) | 144412..144786 | + | 375 | WP_059058540.1 | hypothetical protein | - |
| HHUB_RS16730 (HHUB_4148) | 144819..145121 | + | 303 | WP_089649889.1 | hypothetical protein | - |
| HHUB_RS13880 (HHUB_4149) | 145118..146227 | + | 1110 | WP_143416460.1 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Non-Mobilizable plasmid | - | - | 1..349522 | 349522 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 74 bp
>T10221 NZ_LN831303:c142745-142672 [Halobacterium hubeiense]
GATGAAGCCAATAATATGATGCTTGCCTCAGGGGAGTAGATATTCCTGGTATCTACTCCGGGCCCTAGGCATGT
GATGAAGCCAATAATATGATGCTTGCCTCAGGGGAGTAGATATTCCTGGTATCTACTCCGGGCCCTAGGCATGT
Antitoxin
Download Length: 58 bp
>AT10221 NZ_LN831303:c142567-142510 [Halobacterium hubeiense]
GTTGAAGTTACCAGTATGGTGCCAACACCGTCACAAGTTTCAGATGAACTTCGGTGAG
GTTGAAGTTACCAGTATGGTGCCAACACCGTCACAAGTTTCAGATGAACTTCGGTGAG
References
(1) Feiyue Cheng et al. (2021) Divergent degeneration of creA antitoxin genes from minimal CRISPRs and the convergent strategy of tRNA-sequestering CreT toxins. Nucleic Acids Research 49(18):10677-10688. [PubMed:34551428]