Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1923066..1923337 | Replicon | chromosome |
Accession | NC_000913 | ||
Organism | Escherichia coli str. K-12 substr. MG1655 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1923104..1923207 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1923066..1923337 (+) |
Genomic Context
Location: 1920223..1921662 (1440 bp)
Type: Others
Protein ID: NP_416349.2
Type: Others
Protein ID: NP_416349.2
Location: 1921780..1922016 (237 bp)
Type: Others
Protein ID: NP_416350.4
Type: Others
Protein ID: NP_416350.4
Location: 1922121..1922312 (192 bp)
Type: Others
Protein ID: NP_416351.2
Type: Others
Protein ID: NP_416351.2
Location: 1923066..1923337 (272 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 1925108..1925338 (231 bp)
Type: Others
Protein ID: NP_416356.1
Type: Others
Protein ID: NP_416356.1
Location: 1925440..1926096 (657 bp)
Type: Others
Protein ID: NP_416357.1
Type: Others
Protein ID: NP_416357.1
Location: 1926120..1926782 (663 bp)
Type: Others
Protein ID: NP_416358.1
Type: Others
Protein ID: NP_416358.1
Location: 1922313..1922969 (657 bp)
Type: Others
Protein ID: NP_416352.4
Type: Others
Protein ID: NP_416352.4
Location: 1923104..1923207 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 1923365..1923706 (342 bp)
Type: Others
Protein ID: NP_416353.1
Type: Others
Protein ID: NP_416353.1
Location: 1923719..1924591 (873 bp)
Type: Others
Protein ID: NP_416354.1
Type: Others
Protein ID: NP_416354.1
Location: 1924595..1924969 (375 bp)
Type: Others
Protein ID: NP_416355.1
Type: Others
Protein ID: NP_416355.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
b1835 | 1920223..1921662 | + | 1440 | NP_416349.2 | 16S rRNA m(5)C1407 methyltransferase | - |
b1836 | 1921780..1922016 | + | 237 | NP_416350.4 | DUF1480 domain-containing protein YebV | - |
b1837 | 1922121..1922312 | + | 192 | NP_416351.2 | DUF1482 domain-containing protein YebW | - |
b1838 | 1922313..1922969 | - | 657 | NP_416352.4 | phosphoprotein phosphatase 1 | - |
- | 1923066..1923337 | + | 272 | - | - | Antitoxin |
- | 1923104..1923207 | - | 104 | - | - | Toxin |
b1839 | 1923365..1923706 | - | 342 | NP_416353.1 | DUF2511 domain-containing protein YebY | - |
b1840 | 1923719..1924591 | - | 873 | NP_416354.1 | CopD family protein | - |
b1841 | 1924595..1924969 | - | 375 | NP_416355.1 | copper-binding protein | - |
b1842 | 1925108..1925338 | + | 231 | NP_416356.1 | DNA polymerase III subunit theta | - |
b1843 | 1925440..1926096 | + | 657 | NP_416357.1 | putative carbon-nitrogen hydrolase family protein YobB | - |
b1844 | 1926120..1926782 | + | 663 | NP_416358.1 | exonuclease X | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T10165 NC_000913:c1923207-1923104 [Escherichia coli str. K-12 substr. MG1655]
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
Antitoxin
Download Length: 272 bp
>AT10165 NC_000913:1923066-1923337 [Escherichia coli str. K-12 substr. MG1655]
AAAGTCAGCGAAGGAAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGTGGTGGTCATCAGCTGAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT
AAAGTCAGCGAAGGAAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGTGGTGGTCATCAGCTGAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT
References
(1) Jee Soo Choi et al. (2018) The small RNA, SdsR, acts as a novel type of toxin in Escherichia coli. RNA Biology 15(10):1319-1335. [PubMed:30293519]