Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2020907..2021052 | Replicon | chromosome |
Accession | NZ_CP028548 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2020943..2021045 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2020907..2021052 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CLQ46_RS12420 | 2016037..2018097 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
CLQ46_RS12425 | 2018101..2018760 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
CLQ46_RS12430 | 2018839..2019069 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CLQ46_RS12435 | 2019182..2019556 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CLQ46_RS12440 | 2019560..2020429 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
CLQ46_RS12445 | 2020443..2020784 | + | 342 | WP_015874944.1 | YebY family protein | - |
- | 2020907..2021052 | - | 146 | - | - | Antitoxin |
- | 2020943..2021045 | + | 103 | - | - | Toxin |
CLQ46_RS12450 | 2021087..2021278 | - | 192 | WP_004175432.1 | hypothetical protein | - |
CLQ46_RS12455 | 2021668..2022558 | - | 891 | WP_085353163.1 | VirK/YbjX family protein | - |
CLQ46_RS12460 | 2022793..2023446 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
CLQ46_RS12465 | 2023443..2023634 | - | 192 | WP_002911395.1 | YebW family protein | - |
CLQ46_RS12470 | 2023732..2023971 | - | 240 | WP_002911393.1 | YebV family protein | - |
CLQ46_RS12475 | 2024087..2025520 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T101415 NZ_CP028548:2020943-2021045 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT101415 NZ_CP028548:c2021052-2020907 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT