Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2080873..2081018 | Replicon | chromosome |
Accession | NZ_CP027863 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain CRKP18622 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2080909..2081011 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2080873..2081018 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
C7K64_RS10065 | 2076003..2078063 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
C7K64_RS10070 | 2078067..2078726 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
C7K64_RS10075 | 2078805..2079035 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
C7K64_RS10080 | 2079148..2079522 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
C7K64_RS10085 | 2079526..2080395 | + | 870 | WP_014907333.1 | copper homeostasis membrane protein CopD | - |
C7K64_RS10090 | 2080412..2080750 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2080873..2081018 | - | 146 | - | - | Antitoxin |
- | 2080909..2081011 | + | 103 | - | - | Toxin |
C7K64_RS10095 | 2081386..2081529 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
C7K64_RS10100 | 2081634..2082602 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
C7K64_RS10105 | 2082759..2083412 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
C7K64_RS10110 | 2083409..2083600 | - | 192 | WP_002911395.1 | YebW family protein | - |
C7K64_RS10115 | 2083698..2083937 | - | 240 | WP_002911393.1 | YebV family protein | - |
C7K64_RS10120 | 2084053..2085486 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T100393 NZ_CP027863:2080909-2081011 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT100393 NZ_CP027863:c2081018-2080873 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT