Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | creTA/- |
| Location | 145484..145691 | Replicon | chromosome |
| Accession | NC_015943 | ||
| Organism | Haloarcula hispanica ATCC 33960 | ||
Toxin (RNA)
| Gene name | creT | ||
| Locus tag | - | ||
| Coordinates | 145484..145590 (+) |
Antitoxin (RNA)
| Gene name | creA | ||
| Locus tag | - | ||
| Coordinates | 145651..145691 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HAH_RS15880 (HAH_4165) | 141313..142110 | - | 798 | WP_014030716.1 | type I-B CRISPR-associated protein Cas5b | - |
| HAH_RS15885 (HAH_4166) | 142113..143195 | - | 1083 | WP_014030717.1 | type I-B CRISPR-associated protein Cas7/Csh2 | - |
| HAH_RS15890 (HAH_4167) | 143197..145359 | - | 2163 | WP_044952751.1 | type I-B CRISPR-associated protein Cas8b/Csh1 | - |
| - | 145484..145590 | + | 107 | - | - | Toxin |
| - | 145651..145691 | + | 41 | - | - | Antitoxin |
| HAH_RS15895 (HAH_4168) | 145698..146321 | - | 624 | WP_044952748.1 | CRISPR-associated endoribonuclease Cas6 | - |
| HAH_RS15900 (HAH_4169) | 146698..147930 | - | 1233 | WP_014030720.1 | site-specific integrase | - |
| HAH_RS15905 (HAH_4170) | 147957..148466 | - | 510 | WP_014030721.1 | hypothetical protein | - |
| HAH_RS15910 (HAH_4171) | 148459..148929 | - | 471 | WP_233425869.1 | nucleotidyltransferase domain-containing protein | - |
| HAH_RS15915 | 149556..149732 | - | 177 | WP_233425870.1 | nitrate ABC transporter ATP-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 107 bp
>T10017 NC_015943:145484-145590 [Haloarcula hispanica ATCC 33960]
AAGAAGGGTGATCACATGAGAAGATGATACTCTGGCTGGCATCTGTCCTTGGAAACACTCATGCCAGCCACGATCAGGAG
TATAGGAGAACTCCCTCAATCATATAT
AAGAAGGGTGATCACATGAGAAGATGATACTCTGGCTGGCATCTGTCCTTGGAAACACTCATGCCAGCCACGATCAGGAG
TATAGGAGAACTCCCTCAATCATATAT
Antitoxin
Download Length: 41 bp
>AT10017 NC_015943:145651-145691 [Haloarcula hispanica ATCC 33960]
GTTGAAGTCCTTGGGCTATTGTCCCGATCCCAGTTCATTTT
GTTGAAGTCCTTGGGCTATTGTCCCGATCCCAGTTCATTTT
References
(1) Ming Li et al. (2021) Toxin-antitoxin RNA pairs safeguard CRISPR-Cas systems. Science (New York, N.Y.) 372(6541):eabe5601. [PubMed:33926924]
(2) Feiyue Cheng et al. (2022) The toxin-antitoxin RNA guards of CRISPR-Cas evolved high specificity through repeat degeneration. Nucleic Acids Research 50(16):9442-9452. [PubMed:36018812]