ICEberg
I. Information of IME
ICEberg ID250_IME
Name Tn6215 This IME is derived from experimental literature
Family-
OrganismClostridium difficile CD80
Size (bp)13008 bp
GC content [Genome] (%)
Insertion site-
Functionerm(B)
Species that IME can be transferred toClostridium difficile strain CD062
Nucleotide SequenceKC166248.1 (complete IME sequence in this GenBank file)
Replicon-
Coordinates1..13008
Putative oriT region coordinates: 12809..12843;   oriTDB id:  100185
GTATAACACACTACACTTTGCTTCGCAAAGTCGTG
Putative relaxase coordinates: 2005..2943; Tn6215_03  Family:  MOBV


II. IME interaction with ICE/CIME/Plasmids

The interaction information of Tn6215 is not available.


The graph information of Tn6215 components from KC166248
Complete gene list of Tn6215 from KC166248
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1Tn6215_0132..1609 [-], 1578putative site-specific recombinaseIntegrase 
2Tn6215_021750..1947 [-], 198hypothetical protein
3Tn6215_032005..2943 [-], 939putative plasmid recombination enzymeRelaxase 
4Tn6215_043126..3521 [-], 396putative DNA replication initiator protein A
5Tn6215_053591..4139 [+], 549hypothetical protein
6Tn6215_064424..4969 [+], 546hypothetical protein
7Tn6215_075007..5807 [+], 801putative Xre antitoxin
8Tn6215_085818..6285 [+], 468putative acetyltransferase
9Tn6215_096418..8352 [+], 1935putative type I topoisomerase
10Tn6215_108472..8711 [+], 240putative omega transcriptional repressor
11ermB8758..9495 [+], 738rRNA adenine N-6-methyltransferaseAR 
12Tn6215_1210028..10924 [+], 897putative delta protein
13Tn6215_1311016..11231 [+], 216putative omega transcriptional repressor
14Tn6215_1411248..11520 [+], 273putative epsilon protein
15Tn6215_1511522..11680 [+], 159putative truncated zeta protein
16Tn6215_1611732..12277 [+], 546hypothetical protein
17Tn6215_1712414..12692 [+], 279hypothetical protein
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins17Fasta
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(2) Wasels F; Spigaglia P; Barbanti F; Monot M; Villa L; Dupuy B; Carattoli A; Mastrantonio P (2015). Integration of erm(B)-containing elements through large chromosome fragment exchange in Clostridium difficile. Mob Genet Elements. 5(1):12-16. [PudMed:26442177]
(3) Goh S; Hussain H; Chang BJ; Emmett W; Riley TV; Mullany P (2013). Phage varphiC2 mediates transduction of Tn6215, encoding erythromycin resistance, between Clostridium difficile strains. MBio. 4(6):e00840-13. [PudMed:24255122]
 

Genomics & Bioinformatics Group in MML, SJTU