 ICEberg ID | 250_IME |
Name  | Tn6215  |
| Family | - |
| Organism | Clostridium difficile CD80 |
| Size (bp) | 13008 bp |
| GC content [Genome] (%) | |
| Insertion site | - |
| Function | erm(B) |
| Species that IME can be transferred to | Clostridium difficile strain CD062 |
| Nucleotide Sequence | KC166248.1 (complete IME sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..13008 |
| Putative oriT region | coordinates: 12809..12843; oriTDB id: 100185 GTATAACACACTACACTTTGCTTCGCAAAGTCGTG |
| Putative relaxase | coordinates: 2005..2943; Tn6215_03 Family: MOBV |
The graph information of Tn6215 components from KC166248 | |||||
 | |||||
| Complete gene list of Tn6215 from KC166248 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product | *Reannotation | |
| 1 | Tn6215_01 | 32..1609 [-], 1578 | putative site-specific recombinase | Integrase | |
| 2 | Tn6215_02 | 1750..1947 [-], 198 | hypothetical protein | ||
| 3 | Tn6215_03 | 2005..2943 [-], 939 | putative plasmid recombination enzyme | Relaxase | |
| 4 | Tn6215_04 | 3126..3521 [-], 396 | putative DNA replication initiator protein A | ||
| 5 | Tn6215_05 | 3591..4139 [+], 549 | hypothetical protein | ||
| 6 | Tn6215_06 | 4424..4969 [+], 546 | hypothetical protein | ||
| 7 | Tn6215_07 | 5007..5807 [+], 801 | putative Xre antitoxin | ||
| 8 | Tn6215_08 | 5818..6285 [+], 468 | putative acetyltransferase | ||
| 9 | Tn6215_09 | 6418..8352 [+], 1935 | putative type I topoisomerase | ||
| 10 | Tn6215_10 | 8472..8711 [+], 240 | putative omega transcriptional repressor | ||
| 11 | ermB | 8758..9495 [+], 738 | rRNA adenine N-6-methyltransferase | AR | |
| 12 | Tn6215_12 | 10028..10924 [+], 897 | putative delta protein | ||
| 13 | Tn6215_13 | 11016..11231 [+], 216 | putative omega transcriptional repressor | ||
| 14 | Tn6215_14 | 11248..11520 [+], 273 | putative epsilon protein | ||
| 15 | Tn6215_15 | 11522..11680 [+], 159 | putative truncated zeta protein | ||
| 16 | Tn6215_16 | 11732..12277 [+], 546 | hypothetical protein | ||
| 17 | Tn6215_17 | 12414..12692 [+], 279 | hypothetical protein | ||
 Gene may contribute to site-specific recombination |
 Gene may play role in conjugative transfer |
 Gene may be involved in adaptative function |
| (1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361] |
| (2) Wasels F; Spigaglia P; Barbanti F; Monot M; Villa L; Dupuy B; Carattoli A; Mastrantonio P (2015). Integration of erm(B)-containing elements through large chromosome fragment exchange in Clostridium difficile. Mob Genet Elements. 5(1):12-16. [PudMed:26442177] |
| (3) Goh S; Hussain H; Chang BJ; Emmett W; Riley TV; Mullany P (2013). Phage varphiC2 mediates transduction of Tn6215, encoding erythromycin resistance, between Clostridium difficile strains. MBio. 4(6):e00840-13. [PudMed:24255122] |