ICEberg
I. Information of IME
ICEberg ID239_IME
Name Tn4399 This IME is derived from experimental literature
Family-
OrganismBacteroides fragilis TM4.2321
Size (bp)9.6 kb
GC content [Genome] (%)
Insertion siteNumerous sites
Function-
Species that IME can be transferred to-
Nucleotide SequenceL20975.1 (partical IME sequence)
Putative oriT region coordinates: 991..1189;   oriTDB id:  200009
GATTCGGCATCTAAGCCGTAAATCACATCTTTTTTAGGATAGCAAGTTAATGTCGGCGTATTACATTCCC
CGACCACTTGCCCCTCAAAAAGATGAGGGGAACGGCTCCCGATGGTCACGGACTTTTCAGATTACATCAA
TCGGATTATTCACTAAAAAACAGATAGAACAGATGAAGAAAAACAACATAATCACCTTA
Putative relaxase coordinates: 1461..2417; Locus tag: -;  Family:  MOBP


II. IME interaction with ICE/CIME/Plasmids

The Interaction Network among ICE/IME/CIME/plasmid


Detailed Informatioin of the Interaction Network
# IME  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1Tn4399 CTnDOT [ICE] experimentalin trans Bacteroides Bacteroides 8397185
2Tn4399 pRK231 [IncP plasmid] experimentalin trans Escherichia coli Escherichia coli 8397185
3Tn4399 RP4 [IncP plasmid] experimentalin trans Escherichia coli Escherichia coli 8397185
4Tn4399 R751 [IncP plasmid] experimentalin trans Escherichia coli Escherichia coli 8397185
5Tn4399 pGAT400ΔBglII [nonconjugal plasmid] experimentalin cis Bacteroides fragilis Escherichia coli; Bacteroides fragilis 2544548

experimental This is an interactioin derived from experimental literature


The graph information of Tn4399 components from L20975
Incomplete gene list of Tn4399 from L20975
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1mocB1040..1471 [+], 432MocB
2mocA1461..2417 [+], 957MocARelaxase 
 
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins2Fasta
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381]
(3) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096]
(4) Smith CJ; Parker AC (1996). A gene product related to Tral is required for the mobilization of Bacteroides mobilizable transposons and plasmids. Mol Microbiol. 20(4):741-50. [PudMed:8793871]
(5) Murphy CG; Malamy MH (1993). Characterization of a "mobilization cassette" in transposon Tn4399 from Bacteroides fragilis. J Bacteriol. 175(18):5814-23. [PudMed:8397185]
(6) Murphy CG; Malamy MH (1995). Requirements for strand- and site-specific cleavage within the oriT region of Tn4399, a mobilizing transposon from Bacteroides fragilis. J Bacteriol. 177(11):3158-65. [PudMed:7768814]
(7) Hecht DW; Thompson JS; Malamy MH (1989). Characterization of the termini and transposition products of Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis. Proc Natl Acad Sci U S A. 86(14):5340-4. [PudMed:2546154]
(8) Hecht DW; Malamy MH (1989). Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis. J Bacteriol. 171(7):3603-8. [PudMed:2544548]
 

Genomics & Bioinformatics Group in MML, SJTU