![]() | 239_IME |
![]() ![]() | Tn4399 ![]() |
![]() | - |
![]() | Bacteroides fragilis TM4.2321 |
![]() | 9.6 kb |
![]() | |
![]() | Numerous sites |
![]() | - |
![]() | - |
![]() | L20975.1 (partical IME sequence) |
![]() ![]() | coordinates: 991..1189; oriTDB id: 200009 GATTCGGCATCTAAGCCGTAAATCACATCTTTTTTAGGATAGCAAGTTAATGTCGGCGTATTACATTCCC CGACCACTTGCCCCTCAAAAAGATGAGGGGAACGGCTCCCGATGGTCACGGACTTTTCAGATTACATCAA TCGGATTATTCACTAAAAAACAGATAGAACAGATGAAGAAAAACAACATAATCACCTTA |
![]() ![]() | coordinates: 1461..2417; Locus tag: -; Family: MOBP |
The Interaction Network among ICE/IME/CIME/plasmid | ||||||
![]() | ||||||
Detailed Informatioin of the Interaction Network | ||||||
# | IME ![]() | Inter_Ele![]() | Methods | Donors | Recipients | Exper_Ref ![]() |
1 | Tn4399 | CTnDOT [ICE] | ![]() | Bacteroides | Bacteroides | 8397185 |
2 | Tn4399 | pRK231 [IncP plasmid] | ![]() | Escherichia coli | Escherichia coli | 8397185 |
3 | Tn4399 | RP4 [IncP plasmid] | ![]() | Escherichia coli | Escherichia coli | 8397185 |
4 | Tn4399 | R751 [IncP plasmid] | ![]() | Escherichia coli | Escherichia coli | 8397185 |
5 | Tn4399 | pGAT400ΔBglII [nonconjugal plasmid] | ![]() | Bacteroides fragilis | Escherichia coli; Bacteroides fragilis | 2544548 |
![]() |
The graph information of Tn4399 components from L20975 | |||||
![]() | |||||
Incomplete gene list of Tn4399 from L20975 | |||||
# | Gene | Coordinates [+/-], size (bp) | Product | *Reannotation ![]() | |
1 | mocB | 1040..1471 [+], 432 | MocB | ||
2 | mocA | 1461..2417 [+], 957 | MocA | Relaxase |
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361] |
(2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381] |
(3) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096] |
(4) Smith CJ; Parker AC (1996). A gene product related to Tral is required for the mobilization of Bacteroides mobilizable transposons and plasmids. Mol Microbiol. 20(4):741-50. [PudMed:8793871] |
(5) Murphy CG; Malamy MH (1993). Characterization of a "mobilization cassette" in transposon Tn4399 from Bacteroides fragilis. J Bacteriol. 175(18):5814-23. [PudMed:8397185] |
(6) Murphy CG; Malamy MH (1995). Requirements for strand- and site-specific cleavage within the oriT region of Tn4399, a mobilizing transposon from Bacteroides fragilis. J Bacteriol. 177(11):3158-65. [PudMed:7768814] |
(7) Hecht DW; Thompson JS; Malamy MH (1989). Characterization of the termini and transposition products of Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis. Proc Natl Acad Sci U S A. 86(14):5340-4. [PudMed:2546154] |
(8) Hecht DW; Malamy MH (1989). Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis. J Bacteriol. 171(7):3603-8. [PudMed:2544548] |