 ICEberg ID | 193_IME |
Name  | NBU1  |
| Family | - |
| Organism | Bacteroides uniformis |
| Size (bp) | 10276 bp |
| GC content [Genome] (%) | |
| Insertion site | 3′ of a tRNALeu gene |
| Function | - |
| Species that IME can be transferred to | Bacteroides spp.; Escherichia coli |
| Nucleotide Sequence | AF238307 (complete IME sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..10276 |
| Putative oriT region | coordinates: 8213..8426; oriTDB id: 200010 TCCGCAAGGAATACAGCAGAGACCGATACATCCGTGACGCTTCACAGATTTACAGCGGATGCAAGGACTT GAACGAATACTTACAGAAACAGGTTGAAAGAAAAAGGCAAGTCCAATCCGTCAAAGGGATGAGCAGCCAG TCACCGAAAAAGAAAAACGGCTTTCGGTTATAGCCCACTATAACTACCTCCGCTTTCGTAGTTGTGGGCT CTCC |
| Putative relaxase | coordinates: 8592..9995; Gene: mobN1; Family: - |
The Interaction Network among ICE/IME/CIME/plasmid | ||||||
 | ||||||
| Detailed Informatioin of the Interaction Network | ||||||
| # | IME | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
| 1 | NBU1 | CTnERL [ICE] | in trans | Bacteroides uniformis | Bacteroides thetaiotaomicron 5482; Escherichia coli | 8407835; 7608064 |
| 2 | NBU1 | CTnDOT [ICE] | in trans | Bacteroides uniformis | Bacteroides thetaiotaomicron 5482 | 8407835 |
| 3 | NBU1 | RP4 [IncP plasmid] | in trans | E. coli DH5αMCR | E. coli HB101 | 8407836 |
| 4 | NBU1 | R751 [IncP plasmid] | in trans | Escherichia coli | Escherichia coli; Bacteroides thetaiotaomicron | 8407835; 8407836 |
| This is an interactioin derived from experimental literature |
The graph information of NBU1 components from AF238307 | |||||
 | |||||
| Complete gene list of NBU1 from AF238307 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product | *Reannotation | |
| 1 | - | 36..755 [+], 720 | unknown | ||
| 2 | - | 811..1254 [+], 444 | unknown | ||
| 3 | - | 1264..2004 [+], 741 | unknown | ||
| 4 | - | 2030..2839 [-], 810 | unknown | ||
| 5 | intN1 | 3232..4569 [+], 1338 | IntN1 | Integrase | |
| 6 | - | 4577..5518 [+], 942 | unknown | ||
| 7 | - | 4906..5487 [-], 582 | unknown | ||
| 8 | - | 5688..6002 [+], 315 | unknown | ||
| 9 | - | 6007..7197 [+], 1191 | unknown | ||
| 10 | prmN1 | 7429..8385 [+], 957 | PrmN1 | ||
| 11 | mobN1 | 8592..9995 [+], 1404 | MobN1 | Relaxase | |
 Gene may contribute to site-specific recombination |
 Gene may play role in conjugative transfer |
| (1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361] |
| (2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381] |
| (3) Rajeev L; Malanowska K; Gardner JF (2009). Challenging a paradigm: the role of DNA homology in tyrosine recombinase reactions. Microbiol Mol Biol Rev. 73(2):300-9. [PudMed:19487729] |
| (4) Song B; Wang GR; Shoemaker NB; Salyers AA (2009). An unexpected effect of tetracycline concentration: growth phase-associated excision of the Bacteroides mobilizable transposon NBU1. J Bacteriol. 191(3):1078-82. [PudMed:18952794] |
| (5) Rajeev L; Segall A; Gardner J (2007). The bacteroides NBU1 integrase performs a homology-independent strand exchange to form a holliday junction intermediate. J Biol Chem. 282(43):31228-37. [PudMed:17766246] |
| (6) Rajeev L; Salyers AA; Gardner JF (2006). Characterization of the integrase of NBU1, a Bacteroides mobilizable transposon. Mol Microbiol. 61(4):978-90. [PudMed:16859497] |
| (7) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096] |
| (8) Wang J; Wang GR; Shoemaker NB; Salyers AA (2001). Production of two proteins encoded by the Bacteroides mobilizable transposon NBU1 correlates with time-dependent accumulation of the excised NBu1 circular form. J Bacteriol. 183(21):6335-43. [PudMed:11591678] |
| (9) Wang J; Shoemaker NB; Wang GR; Salyers AA (2000). Characterization of a Bacteroides mobilizable transposon, NBU2, which carries a functional lincomycin resistance gene. J Bacteriol. 182(12):3559-71. [PudMed:10852890] |
| (10) Shoemaker NB; Wang GR; Salyers AA (2000). Multiple gene products and sequences required for excision of the mobilizable integrated Bacteroides element NBU1. J Bacteriol. 182(4):928-36. [PudMed:10648516] |
| (11) Cooper AJ; Kalinowski AP; Shoemaker NB; Salyers AA (1997). Construction and characterization of a Bacteroides thetaiotaomicron recA mutant: transfer of Bacteroides integrated conjugative elements is RecA independent. J Bacteriol. 179(20):6221-7. [PudMed:9335266] |
| (12) Shoemaker NB; Wang GR; Salyers AA (1996). NBU1, a mobilizable site-specific integrated element from Bacteroides spp., can integrate nonspecifically in Escherichia coli. J Bacteriol. 178(12):3601-7. [PudMed:8655560] |
| (13) Shoemaker NB; Wang GR; Salyers AA (1996). The Bacteroides mobilizable insertion element, NBU1, integrates into the 3' end of a Leu-tRNA gene and has an integrase that is a member of the lambda integrase family. J Bacteriol. 178(12):3594-600. [PudMed:8655559] |
| (14) Li LY; Shoemaker NB; Salyers AA (1993). Characterization of the mobilization region of a Bacteroides insertion element (NBU1) that is excised and transferred by Bacteroides conjugative transposons. J Bacteriol. 175(20):6588-98. [PudMed:8407836] |
| (15) Shoemaker NB; Wang GR; Stevens AM; Salyers AA (1993). Excision, transfer, and integration of NBU1, a mobilizable site-selective insertion element. J Bacteriol. 175(20):6578-87. [PudMed:8407835] |
| (16) Shoemaker NB; Li LY; Salyers AA (1994). An unusual type of cointegrate formation between a Bacteroides plasmid and the excised circular form of an integrated element (NBU1). Plasmid. 32(3):312-7. [PudMed:7899516] |
| (17) Li LY; Shoemaker NB; Wang GR; Cole SP; Hashimoto MK; Wang J; Salyers AA (1995). The mobilization regions of two integrated Bacteroides elements, NBU1 and NBU2, have only a single mobilization protein and may be on a cassette. J Bacteriol. 177(14):3940-5. [PudMed:7608064] |
| (18) Shoemaker NB; Salyers AA (1988). Tetracycline-dependent appearance of plasmidlike forms in Bacteroides uniformis 0061 mediated by conjugal Bacteroides tetracycline resistance elements. J Bacteriol. 170(4):1651-7. [PudMed:2832373] |
| (19) Stevens AM; Shoemaker NB; Salyers AA (1990). The region of a Bacteroides conjugal chromosomal tetracycline resistance element which is responsible for production of plasmidlike forms from unlinked chromosomal DNA might also be involved in transfer of the element. J Bacteriol. 172(8):4271-9. [PudMed:2165473] |