 ICEberg ID | 839 |
Name  | ICESsuT15  |
| Organism | Streptococcus suis T15 |
| Size (bp) | 71412 |
| GC content [Genome] (%) | 36.3 |
| Insertion site | CCTCTTATGTCAAGTAACTG(attL)CATTATTATGACACAATCCC(attR) |
| Function | - |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | CP006246 (ICE sequence without defined boundaries) |
| Putative oriT region | - |
| Putative relaxase | - |
| (1) Huang J; Liang Y; Guo D; Shang K; Ge L; Kashif J; Wang L (2016). Comparative Genomic Analysis of the ICESa2603 Family ICEs and Spread of erm(B)- and tet(O)-Carrying Transferable 89K-Subtype ICEs in Swine and Bovine Isolates in China. Front Microbiol. 7:55. [PubMed:26870017] |