![]() | 839 |
![]() ![]() | ICESsuT15 ![]() |
![]() | Streptococcus suis T15 |
![]() | 71412 |
![]() | 36.3 |
![]() | CCTCTTATGTCAAGTAACTG(attL)CATTATTATGACACAATCCC(attR) |
![]() | - |
![]() | - |
![]() | CP006246 (ICE sequence without defined boundaries) |
![]() ![]() | - |
![]() ![]() | - |
(1) Huang J; Liang Y; Guo D; Shang K; Ge L; Kashif J; Wang L (2016). Comparative Genomic Analysis of the ICESa2603 Family ICEs and Spread of erm(B)- and tet(O)-Carrying Transferable 89K-Subtype ICEs in Swine and Bovine Isolates in China. Front Microbiol. 7:55. [PubMed:26870017] |