 oriTDB accession number | 100217 |
| Name | oriT_pIE1107  |
Sequence Completeness  | core |
| oriT length | 37 nt |
| oriT sequence | CAGTTTCTTGAAGAGAAACCGGTAAGTGCGCCCTCCC |
| IR (inverted repeat) | [3-8] [14-19] nt (GTTTCTT..AGAAAC) |
| Location of nic site | [30-31] nt |
| Conserved sequence flanking the nic site | TAAGTGCG|CCCT |
| Note | similar to the oriT of IncQ plasmid RSF101 |
Visualization of oriT structure Reference| [1] Smalla K et al (2000) Exogenous isolation of antibiotic resistance plasmids from piggery manure slurries reveals a high prevalence and diversity of IncQ-like plasmids. Appl Environ Microbiol. 66(11):4854-62. [PMID:11055935] |
| [2] Tietze E (1998) Nucleotide sequence and genetic characterization of the novel IncQ-like plasmid pIE1107. Plasmid. 39(3):165-81. [PMID:9571133] |
| ID | 210 |
| Plasmid name | pIE1107 |
| GenBank accession number | Z74787.1 |
| Incompatibility group | IncQ-like |
| Genome size | 8520 bp |
| Coordinate of oriT [Strand] | 943..979 [-] |
| Drug resistance |  resistance to streptothricin and kanamycin |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Uncultured bacterium [77133] |
Reference| [1] Smalla K et al (2000) Exogenous isolation of antibiotic resistance plasmids from piggery manure slurries reveals a high prevalence and diversity of IncQ-like plasmids. Appl Environ Microbiol. 66(11):4854-62. [PMID:11055935] |