 oriTDB accession number | 100205 |
| Name | oriT_pSW100  |
Sequence Completeness  | core |
| oriT length | 32 nt |
| oriT sequence | CACGTAGCGCTAGCGGAGTGTATACTGGCTTA |
| IR (inverted repeat) | [5-8] [9-12] nt (TAGC..GCTA) |
| Location of nic site | [28-29] nt |
| Conserved sequence flanking the nic site | CTGG|CTTA |
| Note | _ |
Visualization of oriT structure Reference| [1] Dery KJ et al (1997) Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid. 38(2):97-105. [PMID:9339467] |
| ID | 198 |
| Plasmid name | pSW100 |
| GenBank accession number | L37403.1 |
| Incompatibility group | ColRNAI |
| Genome size | > 4272 bp |
| Coordinate of oriT [Strand] | _ |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Erwinia stewartii SW2 [66271] |
Reference