 oriTDB accession number | 100204 |
| Name | oriT_pIMVS1  |
Sequence Completeness  | core |
| oriT length | 63 nt |
| oriT sequence | GGTTTCGGGGCGCAGCCGTGAACCAGTCACGCAGGCGCTAGCGGAGTGTATACTGGCTTA GTA |
| IR (inverted repeat) | [17-21] [27-31] nt (CGTGA..TCACG) [36-39] [40-43] nt (CGCT..AGCG) |
| Location of nic site | [56-57] nt |
| Conserved sequence flanking the nic site | CTGG|CTTA |
| Note | _ |
Visualization of oriT structure Reference| [1] Dery KJ et al (1997) Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid. 38(2):97-105. [PMID:9339467] |
| [2] Astill DS et al (1993) Characterization of the small cryptic plasmid, pIMVS1, of Salmonella enterica ser. Typhimurium.. Plasmid. 30(3):258-67. [PMID:8302933] |
| ID | 197 |
| Plasmid name | pIMVS1 |
| GenBank accession number | X63534.1 |
| Genome size | 3.8 kb |
| Coordinate of oriT [Strand] | _ |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Salmonella enterica serovar Typhimurium [90371] |
Reference