 oriTDB accession number | 100095 |
| Name | oriT_pNPO1  |
Sequence Completeness  | intact |
| oriT length | 174 nt |
| oriT sequence | GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTAA TATGTTGGCACGGATGCGGATGTCAGTGAAGTGCTTCATGTAGCAGGAGAAAAAGGCGGC ACCGGCGCGTCAGCAGAACATGTAGTAACGGGAGATGTGCCGCTTCCTCGCTCA |
| IR (inverted repeat) | IR1: [4-11] [15-22] nt (TTCGGGGC..GCCCTGAA) IR2: [87-91] [94-98] nt (TGAAG..CTTCA) |
| Location of nic site | [55-56] nt |
| Conserved sequence flanking the nic site | CTGG|CTTA |
| Note | |
Visualization of oriT structure Reference| [1] Porres-Osante N et al (2014) Emergence of a multiresistant KPC-3 and VIM-1 carbapenemase-producing Escherichia coli strain in Spain. J Antimicrob Chemother. 69(7):1792-5. [PMID:24583362] |
| ID | 90 |
| Plasmid name | pNPO1 |
| GenBank accession number | KF992024.1 |
| Genome size | 1917 bp |
| Coordinate of oriT [Strand] | 81..254 [+] |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Escherichia coli W1058 [562] |
Reference| [1] Porres-Osante N et al (2014) Emergence of a multiresistant KPC-3 and VIM-1 carbapenemase-producing Escherichia coli strain in Spain. J Antimicrob Chemother. 69(7):1792-5. [PMID:24583362] |