Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122558 |
| Name | oriT1_FDAARGOS_1151|unnamed1  |
| Organism | Staphylococcus pasteuri strain FDAARGOS_1151 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP068220 ( 103678..103798 [+], 121 nt) |
| oriT length | 121 nt |
| IRs (inverted repeats) | 52..59, 61..68 (TTGGGGAT..ATCCCCAA) 22..29, 34..41 (ATTTTTTC..GAAAAAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 121 nt
>oriT1_FDAARGOS_1151|unnamed1
AGTGGCTATCAATTAGACACTATTTTTTCGTTAGAAAAAATCCTAAGGGGCTTGGGGATAATCCCCAACAAGCAGGCGTCGCTACCACGTAAGTGGCTAGCAAAGCCAATGCTTGCCCAAA
AGTGGCTATCAATTAGACACTATTTTTTCGTTAGAAAAAATCCTAAGGGGCTTGGGGATAATCCCCAACAAGCAGGCGTCGCTACCACGTAAGTGGCTAGCAAAGCCAATGCTTGCCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22984 | GenBank | NZ_CP068220 |
| Plasmid name | FDAARGOS_1151|unnamed1 | Incompatibility group | - |
| Plasmid size | 111289 bp | Coordinate of oriT [Strand] | 67939..68059 [-]; 103678..103798 [+] |
| Host baterium | Staphylococcus pasteuri strain FDAARGOS_1151 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsR, arsB, arsC, mco |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |