Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107015
Name   oriT_MT351|unnamed in_silico
Organism   Clostridium sp. MT351
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JQ807734 (507..542 [+], 36 nt)
oriT length   36 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 36 nt

>oriT_MT351|unnamed
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7451 GenBank   NZ_JQ807734
Plasmid name   MT351|unnamed Incompatibility group   -
Plasmid size   3202 bp Coordinate of oriT [Strand]   507..542 [+]
Host baterium   Clostridium sp. MT351

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -