Some of the most important issues in primer picking can be addressed only before using Primer3. These are sequence
quality (including making sure the sequence is not vector and not chimeric) and avoiding repetitive elements.
Techniques for avoiding problems include a thorough understanding of possible vector contaminants and cloning
artifacts coupled with database searches using blast, fasta, or other similarity searching program to screen for
vector contaminants and possible repeats. Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and others, 1995-1996)
ftp://ftp.ncbi.nih.gov/repository/repbase
) is an excellent source of repeat sequences and pointers to the literature. Primer3 now allows you to screen
candidate oligos against a Mispriming Library (or a Mishyb Library in the case of internal oligos).
Sequence quality can be controlled by manual trace viewing and quality clipping or automatic quality clipping
programs. Low-quality bases should be changed to N's or can be made part of Excluded Regions. The beginning of
a sequencing read is often problematic because of primer peaks, and the end of the read often contains many
low-quality or even meaningless called bases. Therefore when picking primers from single-pass sequence it is
often best to use the Included Region parameter to ensure that Primer3 chooses primers in the high quality region
of the read.
In addition, Primer3 takes as input a Sequence Quality list for use with those
base calling programs such as Phred that output this information.
Detection
Cloning
Sequencing
Primer List
Primer Check
The Detection task can be used for designing standard PCR primers or hybridisation oligos to DETECT a given sequence.
The user can indicate:
excluded regions - primers are not allowed to bind in this region
targets - primers must amplify one of the targets
included region - primers must bind within this region
Primer3Plus will select the primer pair which fits best to all selected parameters. It can be located anywhere in the sequence,
only limited by the regions and targets described above.
The Cloning task can be used to design primers ending or starting exactly at the boundary of the
included region.
To clone for example open reading frames the 5'End of the primers should be fixed. Primer3plus
picks primers of various length, all forward primers starting at the same nucleotide (A from ATG)
and all reverse primers starting at the same nucleotide (G from TAG). To have this functionality
the parameter "Fix the x prime end of the primer" in general setting should be set to 5 (default).
To to distinguish between different alleles primers must bind with their 3'End fixed to the varying
nucleotides. If the parameter "Fix the x prime end of the primer" in general setting is set to 3,
primer3plus picks primers of various length, all primers ending at the same nucleotide.
Primer3Plus picks out of all primers the best pair and orders them by quality.
ATTENTION: Due to the inflexibility of the primer position, only the primer length can be altered. In
many cases this leads to primers of low quality. Select the cloning function ONLY if you require
your primers to start or to end at a certain nucleotide.
This parameter can be set to 5 (default) or 3. It indicates for Primer3Plus which End of the primer should be fixed and which can be extended or cut.
The Sequencing task is developed to design a series of primers on both the forward and reverse strands that can be used for custom primer-based (re-)sequencing of clones. Targets can be defined in the sequence which will be sequenced optimally. The pattern how Primer3Plus picks the primers can be modified on the Advanced settings tab:
Defines the space from the start of the primer to the point were the trace signals are readable (default 50 bp).
Defines the space from the start of the primer to the start of the next primer on the same strand (default 500 bp).
Defines the space from the start of the primer to the start of the next primer on the opposite strand (default 250 bp).
Defines the size of the area in which primer3plus searches for the best primer (default 20 bp).
Select "Pick Reverse Primers" to pick also primers on the reverse strand (selected by default).
With the Primer List task all possible primers that can be designed on the target sequence and meet the current settings will be returned with their corresponding characteristics. This task basically allows manual selection of primers. The run time of the Primer List task can be relatively long, especially when lengthy target sequences are submitted.
The Primer Check task can be used to obtain information on a specified primer, like its melting temperature or self complementarity. For this task no template sequence is required and only the primer sequence has to be provided.
A collection of settings for specific applications stored at the server.
Primer3Plus will create automatically a name for each primer based on the Sequence ID, the primer number and the primer acronym.
Acronym for the left primer, by default F
Acronym for the internal oligo, by default IN
Acronym for the right primer, by default R
Spacer primer3plus uses between name, number and acronym, by default _
The sequence from which to select primers or hybridization oligos.
An identifier that is reproduced in the output to enable you to identify the chosen primers.
If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might
be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should
be a space-separated list of
start,lengthpairs where start is the index of the first base of a Target, and length is its length.
Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of
start,lengthpairs where start is the index of the first base of the excluded region, and length is its length. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs.
A list of product size ranges, for example
150-250 100-300 301-400Primer3 first tries to pick primers in the first range. If that is not possible, it goes to the next range and tries again. It continues in this way until it has either picked all necessary primers or until there are no more ranges. For technical reasons this option makes much lighter computational demands than the Product Size option.
Minimum, Optimum, and Maximum lengths (in bases) of the PCR product. Primer3 will not generate primers with products shorter than Min or longer than Max, and with default arguments Primer3 will attempt to pick primers producing products close to the Optimum length.
The maximum number of primer pairs to return. Primer pairs returned are sorted by their "quality", in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time.
The maximum stability for the five 3' bases of a left or right primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Rychlik recommends a maximum value of 9 (Wojciech Rychlik, "Selection of Primers for Polymerase Chain Reaction" in BA White, Ed., "Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications", 1993, pp 31-40, Humana Press, Totowa NJ).
The maximum allowed weighted similarity with any sequence in Mispriming Library. Default is 12.
The maximum allowed sum of similarities of a primer pair (one similarity for each primer) with any single sequence in Mispriming Library. Default is 24. Library sequence weights are not used in computing the sum of similarities.
Minimum, Optimum, and Maximum lengths (in bases) of a primer oligo. Primer3 will not pick primers shorter than Min or longer than Max, and with default arguments will attempt to pick primers close with size close to Opt. Min cannot be smaller than 1. Max cannot be larger than 36. (This limit is governed by maximum oligo size for which melting-temperature calculations are valid.) Min cannot be greater than Max.
Minimum, Optimum, and Maximum melting temperatures (Celsius) for a primer oligo. Primer3 will not pick oligos with
temperatures smaller than Min or larger than Max, and with default conditions will try to pick primers with melting
temperatures close to Opt.
Primer3 uses the oligo melting temperature formula given in Rychlik, Spencer and Rhoads, Nucleic Acids Research,
vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750.
Please refer to the former paper for background discussion.
Maximum acceptable (unsigned) difference between the melting temperatures of the left and right primers.
The minimum, optimum, and maximum melting temperature of the amplicon. Primer3 will not pick a product with melting
temperature less than min or greater than max. If Opt is supplied and the
Penalty Weights for Product Size
are non-0 Primer3 will attempt to pick an amplicon with melting temperature close to Opt.
The maximum allowed melting temperature of the amplicon. Primer3 calculates product Tm calculated using
the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular
Cloning, p 11.46 (1989, CSHL Press).
Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length,where [Na+] is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence.
Minimum, Optimum, and Maximum percentage of Gs and Cs in any primer.
The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the
maximum allowable local alignment score when testing for complementarity between left and right primers. Local
self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing
self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base
(or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example,
the alignment
5' ATCGNA 3'
|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment
5' ATCCGNA 3'
|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local
alignment between two oligos.
The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and
the maximum allowable 3'-anchored global alignment score when testing for complementarity between left and right
primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for
example
5' ATGCCCTAGCTTCCGGATG 3'
||| |||||
3' AAGTCCTACATTTAGCCTAGT 5'
or
5` AGGCTATGGGCCTCGCGA 3'
||||||
3' AGCGCTCCGGGTATCGGA 5'
The scoring system is as for the Max Complementarity argument. In the examples above the scores are 7.00 and
6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored
global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and
primer pairs, Primer assumes that the sequence from which to choose primers is presented 5'->3'. It is nonsensical
to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the
score of a local alignment will always be at least as great as the score of a global alignment.
The maximum allowable length of a mononucleotide repeat, for example AAAAAA.
A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a
sequence are vector, and should be excluded from consideration. The value for this parameter has the form
start,lengthwhere start is the index of the first base to consider, and length is the number of subsequent bases in the primer-picking region.
This parameter should be considered EXPERIMENTAL at this point. Please check the output carefully; some erroneous
inputs might cause an error in Primer3. Index of the first base of a start codon. This parameter allows Primer3
to select primer pairs to create in-frame amplicons e.g. to create a template for a fusion protein. Primer3 will
attempt to select an in-frame left primer, ideally starting at or to the left of the start codon, or to the right
if necessary. Negative values of this parameter are legal if the actual start codon is to the left of available
sequence. If this parameter is non-negative Primer3 signals an error if the codon at the position specified by
this parameter is not an ATG. A value less than or equal to -10^6 indicates that Primer3 should ignore this
parameter.
Primer3 selects the position of the right primer by scanning right from the left primer for a stop codon. Ideally
the right primer will end at or after the stop codon.
This selection indicates what mispriming library (if any) Primer3 should use to screen for interspersed repeats or
for other sequence to avoid as a location for primers. The human and rodent libraries on the web page are adapted
from Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, et al., 1995-1996)
ftp://ftp.ncbi.nih.gov/repository/repbase
. The human library is humrep.ref concatenated with simple.ref, translated to FASTA format. There are two rodent
libraries. One is rodrep.ref translated to FASTA format, and the other is rodrep.ref concatenated with simple.ref,
translated to FASTA format.
The Drosophila library is the concatenation of two libraries from the
Berkeley Drosophila Genome Project:
Require the specified number of consecutive Gs and Cs at the 3' end of both the left and right primer. (This parameter has no effect on the hybridization oligo if one is requested.)
The millimolar concentration of salt (usually KCl) in the PCR. Primer3 uses this argument to calculate oligo melting temperatures.
The nanomolar concentration of annealing oligos in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is "empirically determined". The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures.
Maximum number of unknown bases (N) allowable in any primer.
This parameter provides a quick-and-dirty way to get Primer3 to accept IUB / IUPAC codes for ambiguous bases (i.e. by changing all unrecognized bases to N). If you wish to include an ambiguous base in an oligo, you must set Max Ns Accepted to a non-0 value. Perhaps '-' and '* ' should be squeezed out rather than changed to 'N', but currently they simply get converted to N's. The authors invite user comments.
The index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) In the WWW interface this parameter defaults to 1.
Non-default values valid only for sequences with 0 or 1 target regions. If the primer is part of a pair that spans a target and overlaps the target, then multiply this value times the number of nucleotide positions by which the primer overlaps the (unique) target to get the 'position penalty'. The effect of this parameter is to allow Primer3 to include overlap with the target as a term in the objective function.
Non-default values valid only for sequences with 0 or 1 target regions. If the primer is part of a pair that spans a target and does not overlap the target, then multiply this value times the number of nucleotide positions from the 3' end to the (unique) target to get the 'position penalty'. The effect of this parameter is to allow Primer3 to include nearness to the target as a term in the objective function.
Include the input to primer3_core as part of the output.
A list of space separated integers. There must be exactly one integer for each base in the Source Sequence if this argument is non-empty. High numbers indicate high confidence in the base call at that position and low numbers indicate low confidence in the base call at that position.
The minimum sequence quality (as specified by Sequence Quality) allowed within a primer.
The minimum sequence quality (as specified by Sequence Quality) allowed within the 3' pentamer of a primer.
The minimum legal sequence quality (used for interpreting Min Sequence Quality and Min 3' Sequence Quality).
The maximum legal sequence quality (used for interpreting Min Sequence Quality and Min 3' Sequence Quality).
This section describes "penalty weights", which allow the user to modify the criteria that Primer3 uses to select the "best" primers. There are two classes of weights: for some parameters there is a 'Lt' (less than) and a 'Gt' (greater than) weight. These are the weights that Primer3 uses when the value is less or greater than (respectively) the specified optimum. The following parameters have both 'Lt' and 'Gt' weights:
Parameters governing choice of internal oligos are analogous to the parameters governing choice of primer pairs. The exception is Max 3' Complementarity which is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that Max 3' Complementarity be set at least as high as Max Complementarity.