Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 882631..882776 | Replicon | chromosome |
| Accession | NZ_CP025757 | ||
| Organism | Citrobacter freundii complex sp. CFNIH2 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 882666..882769 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 882631..882776 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| WM46_RS04385 | 879087..879749 | - | 663 | WP_043000375.1 | exodeoxyribonuclease X | - |
| WM46_RS04390 | 879773..880429 | - | 657 | WP_102601527.1 | carbon-nitrogen hydrolase family protein | - |
| WM46_RS04395 | 880538..880768 | - | 231 | WP_042318454.1 | DNA polymerase III subunit theta | - |
| WM46_RS04400 | 880906..881280 | + | 375 | WP_061077805.1 | CopC domain-containing protein YobA | - |
| WM46_RS04405 | 881283..882155 | + | 873 | WP_102601528.1 | copper homeostasis membrane protein CopD | - |
| WM46_RS04410 | 882172..882510 | + | 339 | WP_061077803.1 | YebY family protein | - |
| - | 882631..882776 | - | 146 | - | - | Antitoxin |
| - | 882666..882769 | + | 104 | - | - | Toxin |
| WM46_RS04415 | 882847..883931 | - | 1085 | Protein_835 | phage integrase Arm DNA-binding domain-containing protein | - |
| WM46_RS04420 | 883900..884172 | - | 273 | WP_102601529.1 | excisionase | - |
| WM46_RS04425 | 884332..884634 | - | 303 | WP_059290846.1 | hypothetical protein | - |
| WM46_RS04430 | 884675..885016 | - | 342 | WP_102601530.1 | hypothetical protein | - |
| WM46_RS04435 | 884934..885248 | - | 315 | WP_102601531.1 | DUF4222 domain-containing protein | - |
| WM46_RS04440 | 885226..885564 | - | 339 | WP_102603772.1 | DUF2591 family protein | - |
| WM46_RS04445 | 885580..885771 | - | 192 | Protein_841 | TraR/DksA C4-type zinc finger protein | - |
| WM46_RS04450 | 885863..886054 | - | 192 | WP_102601532.1 | DUF1382 family protein | - |
| WM46_RS04455 | 886051..886347 | - | 297 | WP_102601533.1 | DUF4406 domain-containing protein | - |
| WM46_RS04460 | 886344..886562 | - | 219 | WP_045332436.1 | hypothetical protein | - |
| WM46_RS04465 | 886559..887053 | - | 495 | WP_049108575.1 | HNH endonuclease | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 877030..953602 | 76572 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T91935 NZ_CP025757:882666-882769 [Citrobacter freundii complex sp. CFNIH2]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT91935 NZ_CP025757:c882776-882631 [Citrobacter freundii complex sp. CFNIH2]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
